90 books
—
7 voters
Jasmine
https://www.goodreads.com/diewolke
“I dislike the manipulation that's necessary to press all the images of a
film into one story; it's very harmful for the images because it tends to
drain them of their 'life'. In the relationship between story and image, I
see the story as a kind of vampire, trying to suck all the blood from an
image. Images are acutely sensitive; like snails they shrink back when you
touch their horns. They don't have it in them to be carthorses: carrying
and transporting messages or significance or intention or a moral. But
that's precisely what a story wants from them.”
―
film into one story; it's very harmful for the images because it tends to
drain them of their 'life'. In the relationship between story and image, I
see the story as a kind of vampire, trying to suck all the blood from an
image. Images are acutely sensitive; like snails they shrink back when you
touch their horns. They don't have it in them to be carthorses: carrying
and transporting messages or significance or intention or a moral. But
that's precisely what a story wants from them.”
―
“That’s where the ends of the earth are,” he said. “Where?” “The place you think isn’t fair. You can’t do anything about it, right?”
― Penguin Highway
― Penguin Highway
“Terayama Shuuji once said “Throw away your books, rally in the streets”.
But back then, I thought — rally in the streets, and then what?”
― 四畳半神話大系
But back then, I thought — rally in the streets, and then what?”
― 四畳半神話大系
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Fanged Noumena: Collected Writings 1987 - 2007
― Fanged Noumena: Collected Writings 1987 - 2007
“Life has become the ideology of its own absence.”
― Minima Moralia: Reflections on a Damaged Life
― Minima Moralia: Reflections on a Damaged Life
Goodreads Librarians Group
— 321063 members
— last activity 0 minutes ago
Goodreads Librarians are volunteers who help ensure the accuracy of information about books and authors in the Goodreads' catalog. The Goodreads Libra ...more
/lit/ (2025 revival edition)
— 1281 members
— last activity 8 hours, 7 min ago
No fun allowed. Reading top 100 books from the /lit/ chart.
Corpus Linguistics Reading Group @UMass Boston
— 6 members
— last activity Aug 11, 2020 09:20PM
A reading group for applied linguistics students interested in reading and researching the topic of corpus linguistics. We're interested in both eleme ...more
Books2Movies Club
— 2499 members
— last activity May 01, 2023 11:36AM
Have you read the book, seen the movie, neither – but you are eager to read and see both? Then this is absolutely perfect group for you! We like to se ...more
Eastern European Literature
— 65 members
— last activity Sep 03, 2017 05:59AM
Everything from the Alexander Radishchev's "Journey from St. Petersburg to Moscow" to Dorota Masłowska's "White and Red." This group is for anyone who ...more
Jasmine’s 2025 Year in Books
Take a look at Jasmine’s Year in Books, including some fun facts about their reading.
More friends…
Favorite Genres
Art, Manga, Music, Non-fiction, Philosophy, Poetry, Politics, Religion, Science, literary-criticism, theatre, criticism, language, linguistics, Chess, eastern-philosophy, metaphysics, political-science, folklore, mythology, film, cultural, counter-culture, european-literature, french-literature, literature, russian-literature, middle-english-literature, old-english-literature, asian-literature, international-literature, african-literature, egyptian-literature, latin-american-literature, multicultural-literature, black-literature, and urbanism
Polls voted on by Jasmine
Lists liked by Jasmine



























