Jasmine

“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

“I dislike the manipulation that's necessary to press all the images of a
film into one story; it's very harmful for the images because it tends to
drain them of their 'life'. In the relationship between story and image, I
see the story as a kind of vampire, trying to suck all the blood from an
image. Images are acutely sensitive; like snails they shrink back when you
touch their horns. They don't have it in them to be carthorses: carrying
and transporting messages or significance or intention or a moral. But
that's precisely what a story wants from them.”
― Wim Wenders

“There is nothing more useless than a organ. When you have given him a body without organs, then you will have delivered him from all his automatisms and restored him to his true liberty.”
― Antonin Artaud, Watchfiends and Rack Screams: Works from the Final Period

“I Hear that the Axe has Flowered

I hear that the axe has flowered,
I hear that the place can't be named,

I hear that the bread which looks at him
heals the hanged man,
the bread baked for him by his wife,

I hear that they call life
our only refuge.”
― Paul Celan, Selected Poems