32 books
—
13 voters
Discover new books on Goodreads
Meet your next favorite book
Jasmine
https://www.goodreads.com/diewolke
“Who are we to judge the needs of another man’s heart?”
― Kokoro
― Kokoro
“Life has become the ideology of its own absence.”
― Minima Moralia: Reflections on a Damaged Life
― Minima Moralia: Reflections on a Damaged Life
“That’s where the ends of the earth are,” he said. “Where?” “The place you think isn’t fair. You can’t do anything about it, right?”
― Penguin Highway
― Penguin Highway
“Every film is political. Most political of all are those that pretend not to
be: 'entertainment' movies. They are the most political films there are
because they dismiss the possibility of change. In every frame they tell
you everything's fine the way it is. They are a continual advertisement for
things as they are.”
―
be: 'entertainment' movies. They are the most political films there are
because they dismiss the possibility of change. In every frame they tell
you everything's fine the way it is. They are a continual advertisement for
things as they are.”
―
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Fanged Noumena: Collected Writings 1987 - 2007
― Fanged Noumena: Collected Writings 1987 - 2007
Goodreads Librarians Group
— 339765 members
— last activity 0 minutes ago
Goodreads Librarians are volunteers who help ensure the accuracy of information about books and authors in the Goodreads' catalog. The Goodreads Libra ...more
/lit/ (2025 revival edition)
— 1280 members
— last activity Jun 24, 2026 04:00AM
No fun allowed. Reading top 100 books from the /lit/ chart.
Corpus Linguistics Reading Group @UMass Boston
— 6 members
— last activity Aug 11, 2020 09:20PM
A reading group for applied linguistics students interested in reading and researching the topic of corpus linguistics. We're interested in both eleme ...more
Books2Movies Club
— 2494 members
— last activity May 01, 2023 11:36AM
Have you read the book, seen the movie, neither – but you are eager to read and see both? Then this is absolutely perfect group for you! We like to se ...more
Eastern European Literature
— 66 members
— last activity Sep 03, 2017 05:59AM
Everything from the Alexander Radishchev's "Journey from St. Petersburg to Moscow" to Dorota Masłowska's "White and Red." This group is for anyone who ...more
Jasmine’s 2025 Year in Books
Take a look at Jasmine’s Year in Books, including some fun facts about their reading.
528 books
|
169 friends
654 books
|
169 friends
5,308 books
|
108 friends
2,062 books
|
5,336 friends
1,951 books
|
285 friends
3,154 books
|
170 friends
262 books
|
7 friends
35,474 books
|
280 friends
More friends…
Favorite Genres
Art, Manga, Music, Non-fiction, Philosophy, Poetry, Politics, Religion, Science, literary-criticism, theatre, criticism, language, linguistics, Chess, eastern-philosophy, metaphysics, political-science, folklore, mythology, film, cultural, counter-culture, european-literature, french-literature, literature, russian-literature, middle-english-literature, old-english-literature, asian-literature, international-literature, african-literature, egyptian-literature, latin-american-literature, multicultural-literature, black-literature, and urbanism
Polls voted on by Jasmine
Lists liked by Jasmine