Jasmine > Jasmine's Quotes

“It is at work everywhere, functioning smoothly at times, at other times in fits and starts. It breathes, it heats, it eats. It shits and fucks. What a mistake to have ever said the id.”
― Gilles Deleuze, Anti-Oedipus: Capitalism and Schizophrenia

“Incontinent the void. The zenith. Evening again. When not night it will be evening. Death again of deathless day. On one hand embers. On the other ashes. Day without end won and lost. Unseen.”
― Samuel Beckett, Ill Seen Ill Said

“Already all confusion. Things and imaginings. As of always. Confusion amounting to nothing. Despite precautions. If only she could be pure figment. Unalloyed. This old so dying woman. So dead. In the madhouse of the skull and nowhere else. Where no more precautions to be taken. No precautions possible. Cooped up there with the rest. Hovel and stones. The lot. And the eye. How simple all then. If only all could be pure figment. Neither be nor been nor by any shift to be. Gently gently. On. Careful.”
― Samuel Beckett, Ill Seen Ill Said

“Parting is such sweet sorrow that I shall say goodnight till it be morrow.”
― Shakespeare, Romeo and Juliet

“If there is a conclusion it is zero.”
― Nick Land, The Thirst for Annihilation: Georges Bataille and Virulent Nihilism

“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Nick Land, Fanged Noumena: Collected Writings 1987 - 2007

“Who are we to judge the needs of another man’s heart?”
― Natsume Soseki, Kokoro

“I dream that I have found us both again,
With spring so many strangers' lives away,
And we, so free,
Out walking by the sea,
With someone else's paper words to say....

They took us at the gates of green return,
Too lost by then to stop, and ask them why-
Do children meet again?
Does any trace remain,
Along the superhighways of July?”
― Thomas Pynchon, Gravity’s Rainbow

“My candle burns at both ends;
It will not last the night;
But ah, my foes, and oh, my friends—
It gives a lovely light!”
― Edna St. Vincent Millay, A Few Figs from Thistles

“They didn't have much trouble
teaching the ape to write poems:
first they strapped him into a chair,
then tied the pencil around his hand
(the paper had already been nailed down).
Then Dr. Bluespire leaned over his shoulder
and whispered into his ear:
'You look like a god sitting there.
Why don't you try writing something?”
― James Tate, Selected Poems

“Your hair waves once more when I weep. With the blue of your eyes
you lay the table of love: a bed between summer and autumn.
We drink what somebody brewed, neither I nor you nor a third:
we lap up some empty and last thing.

We watch ourselves in the deep sea’s mirrors and faster pass food to the other:
the night is the night, it begins with the morning,
beside you it lays me down.

("The Years From You To Me")”
― Paul Celan, Poems of Paul Celan

“Black milk of daybreak we drink it at sundown
we drink it at noon in the morning we drink it at night
we drink and we drink it
we dig a grave in the breezes there one lies unconfined
A man lives in the house he plays with the serpents he writes
he writes when dusk falls to Germany your golden hair Margarete
he writes it and steps out of doors and the stars are flashing he whistles his pack out
he whistles his Jews out in earth has them dig for a grave
he commands us strike up for the dance

Black milk of daybreak we drink you at night
we drink in the morning at noon we drink you at sundown
we drink and we drink you
A man lives in the house he plays with the serpents he writes
he writes when dusk falls to Germany your golden hair Margarete
your ashen hair Shulamith we dig a grave in the breezes there one lies unconfined

He calls out jab deeper into the earth you lot you others sing now and play
he grabs at the iron in his belt he waves it his eyes are blue
jab deeper you lot with your spades you others play on for the dance

Black milk of daybreak we drink you at night
we drink you at noon in the morning we drink you at sundown
we drink and we drink you
A man lives in the house your golden hair Margarete
your ashen hair Shulamith he plays with the serpents
He calls out more sweetly play death death is a master from Germany
he calls out more darkly now stroke your strings then as smoke you will rise into air
then a grave you will have in the clouds there one lies unconfined

Black milk of daybreak we drink you at night
we drink you at noon death is a master from Germany
we drink you at sundown and in the morning we drink and we drink you
death is a master from Germany his eyes are blue
he strikes you with leaden bullets his aim is true
a man lives in the house your golden hair Margarete
he sets his pack on to us he grants us a grave in the air
he plays with the serpents and daydreams death is a master from Germany

your golden hair Margarete
your ashen hair Shulamith

("Death Fugue")”
― Paul Celan, Poems of Paul Celan

“What times are these when a conversation is almost a crime because it includes so much made explicit?”
― Paul Celan, Poems of Paul Celan

“I Hear that the Axe has Flowered

I hear that the axe has flowered,
I hear that the place can't be named,

I hear that the bread which looks at him
heals the hanged man,
the bread baked for him by his wife,

I hear that they call life
our only refuge.”
― Paul Celan, Selected Poems

“All writing is filth”
― Antonin Artaud, The Theater and Its Double

“If there is still one hellish, truly accursed thing in our time, it is our artistic dallying with forms, instead of being like victims burnt at the stake, signaling through the flames.”
― Antonin Artaud, The Theater and Its Double

“All those who have vantage points in their spirit... ; all those who are masters of their language; all those for whom words have a meaning; all those for whom there exist sublimities in the soul and currents of thought; all those who are the spirit of the times, and have named these currents of thought -- and I am thinking of their precise works, of that automatic grinding that delivers their spirit to the winds --
are pigs.”
― Antonin Artaud, Artaud Anthology

“There is nothing more useless than a organ. When you have given him a body without organs, then you will have delivered him from all his automatisms and restored him to his true liberty.”
― Antonin Artaud, Watchfiends and Rack Screams: Works from the Final Period

“An object, after all, is what makes infinity private.”
― Joseph Brodsky, Watermark

“The real history of consciousness starts with one's first lie.”
― Joseph Brodsky, Less Than One: Selected Essays

“Terayama Shuuji once said “Throw away your books, rally in the streets”.
But back then, I thought — rally in the streets, and then what?”
― Tomihiko Morimi, 四畳半神話大系

“The ends of the world were inside the world when it folded in on itself.”
― Tomihiko Morimi, Penguin Highway

“That’s where the ends of the earth are,” he said. “Where?” “The place you think isn’t fair. You can’t do anything about it, right?”
― Tomihiko Morimi, Penguin Highway

“I am nothing but I must be everything.”
― Karl Marx, Critique of Hegel's Philosophy of Right

“In a traditional German toilet, the hole into which shit disappears after we flush is right at the front, so that shit is first laid out for us to sniff and inspect for traces of illness. In the typical French toilet, on the contrary, the hole is at the back, i.e. shit is supposed to disappear as quickly as possible. Finally, the American (Anglo-Saxon) toilet presents a synthesis, a mediation between these opposites: the toilet basin is full of water, so that the shit floats in it, visible, but not to be inspected. [...] It is clear that none of these versions can be accounted for in purely utilitarian terms: each involves a certain ideological perception of how the subject should relate to excrement. Hegel was among the first to see in the geographical triad of Germany, France and England an expression of three different existential attitudes: reflective thoroughness (German), revolutionary hastiness (French), utilitarian pragmatism (English). In political terms, this triad can be read as German conservatism, French revolutionary radicalism and English liberalism. [...] The point about toilets is that they enable us not only to discern this triad in the most intimate domain, but also to identify its underlying mechanism in the three different attitudes towards excremental excess: an ambiguous contemplative fascination; a wish to get rid of it as fast as possible; a pragmatic decision to treat it as ordinary and dispose of it in an appropriate way. It is easy for an academic at a round table to claim that we live in a post-ideological universe, but the moment he visits the lavatory after the heated discussion, he is again knee-deep in ideology.”
― Slavoj Žižek, The Plague of Fantasies

“What did he mean by "society"? The plural of human beings?”
― Osamu Dazai, No Longer Human

“The shame of being a man - is there any better reason to write?”
― Gilles Deleuze

“Shit on your whole mortifying, imaginary, and symbolic theater!”
― Gilles Deleuze, Anti-Oedipus: Capitalism and Schizophrenia

“I discovered, for the first time but not the last, that politicians don’t care too much what things cost. It’s not their money.”
― Donald J. Trump, Trump: The Art of the Deal

“Melancholy: an appetite no misery satisfies.”
― Emil Cioran, All Gall is Divided: Aphorisms