Fanged Noumena Quotes

Rate this book
Clear rating
Fanged Noumena: Collected Writings, 1987–2007 Fanged Noumena: Collected Writings, 1987–2007 by Nick Land
1,314 ratings, 3.83 average rating, 178 reviews
Open Preview
Fanged Noumena Quotes Showing 1-25 of 25
“Whenever its name has been anything but a jest, philosophy has been haunted by a subterranean question: What if knowledge were a means to deepen unknowing?”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Machinic desire can seem a little inhuman, as it rips up political cultures, deletes traditions, dissolves subjectivities, and hacks through security apparatuses, tracking a soulless tropism to zero control. This is because what appears to humanity as the history of capitalism is an invasion from the future by an artificial intelligent space that must assemble itself entirely from its enemy's resources.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“[[ ]] The story goes like this: Earth is captured by a technocapital singularity as renaissance rationalization and oceanic navigation lock into commoditization take-off. Logistically accelerating techno-economic interactivity crumbles social order in auto sophisticating machine runaway. As markets learn to manufacture intelligence, politics modernizes, upgrades paranoia, and tries to get a grip.

The body count climbs through a series of globewars. Emergent Planetary Commercium trashes the Holy Roman Empire, the Napoleonic Continental System, the Second and Third Reich, and the Soviet International, cranking-up world disorder through compressing phases. Deregulation and the state arms-race each other into cyberspace.

By the time soft-engineering slithers out of its box into yours, human security is lurching into crisis. Cloning, lateral genodata transfer, transversal replication, and cyberotics, flood in amongst a relapse onto bacterial sex.

Neo-China arrives from the future.

Hypersynthetic drugs click into digital voodoo.

Retro-disease.

Nanospasm.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“After all, the ideal of bourgeois politics is the absence of politics, since capital is nothing other than the consistent displacement of social decision-making into the marketplace”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Organs crawl like aphids upon the immobile motor of becoming”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Was Trakl a Christian? Yes, of course, at times he becomes a Christian, among a general confusion of becomings—becoming an animal, becoming a virus, becoming inorganic—just as he was also an antichrist, a poet, a pharmacist, an alcoholic, a drug addict, a psychotic, a leper, a suicide, an incestuous cannibal, a necrophiliac, a rodent, a vampire, and a werewolf. Just as he became his sister, and also a hermaphrodite. Trakl's texts are scrawled over by redemptionist monotheism, just as they are stained by narcotic fluidities, gnawed by rats, cratered by Russian artillery, charred and pitted by astronomical debris. Trakl was a Christian and an atheist and also a Satanist, when he wasn't simply undead, or in some other way inhuman. It is perhaps more precise to say that Trakl never existed, except as a battlefield, a reservoir of disease, the graveyard of a deconsecrated church, as something expiring from a massive cocaine overdose on the floor of a military hospital, cheated by lucidity by the searing onslaught of base difference.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“The great educational value of the war against Christendom lies in the absolute truthlessness of the priest. Such purity is rare enough. The 'man of God' is entirely incapable of honesty, and only arises at the point where truth is defaced beyond all legibility. Lies are his entire metabolism, the air he breathes, his bread and his wine. He cannot comment upon the weather without a secret agenda of deceit. No word, gesture, or perception is slight enough to escape his extravagant reflex of falsification, and of the lies in circulation he will instinctively seize on the grossest, the most obscene and oppressive travesty. Any proposition passing the lips of a priest is necessarily totally false, excepting only insidiouses whose message is momentarily misunderstood. It is impossible to deny him without discovering some buried fragment or reality.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Far from being the acme of religion — let alone its telic blossoming — God is the principle of its suppression. The unity of theos is the tombstone of sacred zero, the crumbling granitic foundation of secular destitution.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Philosophy, in its longing to rationalize, formalize, define, delimit, to terminate enigma and uncertainty, to co-operate wholeheartedly with the police, is nihilistic in the ultimate sense that it strives for the immobile perfection of death. But creativity cannot be brought to an end that is compatible with power, for unless life is extinguished, control must inevitably break down. We possess art lest we perish of the truth.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“The infrastructure of power is human neurosoft compatible ROM. Authority instantiates itself as linear instruction pathways, genetic baboonery, scriptures, traditions, rituals, and gerontocratic hierarchies, resonant with the dominator ur-myth that the nature of reality has already been decided. If you want to find ICE, try thinking about what is blocking you out of the past. It certainly isn’t a law of nature. Temporalization decompresses intensity, installing constraint.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
Nick Land, Fanged Noumena: Collected Writings 1987 - 2007
“Philosophy has an affinity with despotism, due to its predilection for Platonic-fascist top-down solutions that always screw up viciously. Schizoanalysis works differently. It avoids Ideas, and sticks to diagrams: networking software for accessing bodies without organs.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Neo-China arrives from the future.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“The obsolete psychological category of 'greed' privatizes and moralizes addiction, as if the profit-seeking tropism of a transnational capitalism propagating itself through epidemic consumerism were intelligible in terms of personal subjective traits. Wanting more is the index of interlock with cyberpositive machinic processes, and of personal subjective traits [...] Addiction comes out of the future [...] Money communicates with the primary process because of what it can melt, not what it can obtain.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Nothing is more complex than simplification; what art takes from enigma it more than replenishes in the instantiation of itself, in the labyrinthine puzzle it plants in history. The intensification of enigma. The luxuriantly problematic loam of existence is built out of the sedimented aeons of residues deposited by the will to power, the impulse to create.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Drives are the functions of nomadic cybernetic systems, not instincts, but simulated instincts , artificial instincts. They arc plastic replacements for hard-wired instinctual responses, routing a sensory-motor pathway through the virtual machine of the unconscious . There are two basic diagrams for such processes : that of regulation by negative feedback which suppresses difference and seeks equilibrium, or that of guidance by positive feedback which reinforces difference and escapes equilibrium. Machinic processes are either cyberpositive-nomadic, with a deterritorializing outcome, or cybernegative-sedentary, with a reterritorializing outcome.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“The story goes like this: Earth is captured by a technocapital singularity as renaissance rationalization and oceanic navigation lock into commoditization take-off. Logistically accelerating techno-economic interactivity crumbles social order in auto sophisticating machine runaway. As markets learn to manufacture intelligence, politics modernizes, upgrades paranoia, and tries to get a grip.

The body count climbs through a series of globewars. Emergent Planetary Commercium trashes the Holy Roman Empire, the Napoleonic Continental System, the Second and Third Reich, and the Soviet International, cranking-up world disorder through compressing phases. Deregulation and the state arms-race each other into cyberspace.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Will Christendom ever reap the whirlwind it has sown? That it should try to pass, without the vulnerability of interval, from a tyranny to a joke, is certainly understandable, but that its enemies should do nothing to obstruct its evasion of nemesis is more puzzling. How can there be such indifference to the decline of our inquisitors? Is it that they succeed so exorbitantly in their project of domestication that we have been robbed of every impulse to bite back? Having at last escaped from the torture-palace of authoritarian love we shuffle about, numb and confused, flinching from the twisted septic wound of our past (now clumsily bandaged with the rags of secular culture). It is painfully evident that post-christian humanity is a pack of broken dogs.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Cybergothic is [...] guided by schizoanalysis in marking actuality as primary repression or collapsed potential”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“[[ ]] K-tactics. The bacterial or xenogenetic diagram is not restricted to the microbial scale. Macrobacterial assemblages collapse generational hierarchies of reproductive wisdom into lateral networks of replicator experimentation. There is no true biological primitiveness – all extant bio-systems being equally evolved – so there is no true ignorance. It is only the accumulative-gerontocratic model of learning that depicts synchronic connectivity deficiency as diachronic underdevelopment.

Foucault delineates the contours of power as a strategy without a subject: ROM locking learning in a box. Its enemy is a tactics without a strategy, replacing the politico-territorial imagery of conquest and resistance with nomad-micromilitary sabotage and evasion, reinforcing intelligence.

All political institutions are cyberian military targets.

Take universities, for instance.

Learning surrenders control to the future, threatening established power. It is vigorously suppressed by all political structures, which replace it with a docilizing and conformist education, reproducing privilege as wisdom. Schools are social devices whose specific function is to incapacitate learning, and universities are employed to legitimate schooling through perpetual reconstitution of global social memory.

The meltdown of metropolitan education systems in the near future is accompanied by a quasi-punctual bottom-up takeover of academic institutions, precipitating their mutation into amnesiac cataspace-exploration zones and bases manufacturing cyberian soft-weaponry.

To be continued.”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Stabilization circuits suppress mutation, whilst short-range runaway circuits propagate it only in an unsustainable burst, before cancelling it entirely. Neither of these figures approximate to self-designing processes or long-range runaway circuits, such as Nietzsche’s will to power, Freud’s phylogenetic thanatos, or Prigogine’s dissipative structures. Long-range runaway processes are self-designing, but only in such a way that the self is perpetuated as something redesigned. If this is a vicious circle it is because positive cybernetics must always be described as such. Logic, after all, is from the start theology. (298)”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“A machinic assemblage is cybernetic to the extent that its inputs program its outputs and its outputs program its inputs, with incomplete closure, and without reciprocity. This necessitates that cybernetic systems emerge upon a fusional plane that reconnects their outputs with their inputs in an ‘auto-production of the unconscious’. The inside programs its reprogramming through the outside, according to ‘cyclical movement by which the unconscious, always remaining “subject”, reproduc(es) itself’, without having ever definitively antedated its reprogramming (‘generation … is secondary in relation to the cycle’). It is thus that machinic processes are not merely functions, but also sufficient conditions for the replenishing of functioning; immanent reprogrammings of the real, ‘not merely functioning, but formation and autoproduction’. (296)”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Long-range positive feedback is neither homeostatic, nor amplificatory, but escalative. Where modernist cybernetic models of negative and positive feedback are integrated, escalation is integrating or cyber-emergent. It is the machinic convergence of uncoordinated elements, a phase-change from linear to non-linear dynamics. Design no longer leads back towards a divine origin, because once shifted into cybernetics it ceases to commensurate with the theopolitical ideal of the plan. Planning is the creationist symptom of underdesigned software circuits, associated with domination, tradition, and inhibition; with everything that shackles the future to the past. All planning is theopolitics, and theopolitics is cybernetics in a swamp. (296)”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“Design no longer leads back towards a divine origin, because once shifted into cybernetics it ceases to commensurate with the theopolitical ideal of the plan. Planning is the creationist symptom of underdesigned software circuits, associated with domination, tradition, and inhibition; with everything that shackles the future to the past. All planning is theopolitics, and theopolitics is cybernetics in a swamp. (298-9)”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007
“If machinery is conceived transcendently as instrumental technology it is essentially determined in opposition to social relations, but if it is integrated immanently as cybernetic technics it redesigns all oppositionality as non-linear flow. There is no dialectic between social and technical relations, but only a machinism that dissolves society into the machines whilst deterritorializing the machines across the ruins of society, whose ‘general theory … is a generalized theory of flux’, which is to say: cybernetics. Beyond the assumption that guidance proceeds from the side of the subject lies desiring production: the impersonal pilot of history. Distinctions between theory and practice, culture and economy, science and technics, are useless after this point. There is no real option between a cybernetics of theory or a theory of cybernetics, because cybernetics is neither a theory nor its object, but an operation within anobjective partial circuits that reiterates ‘itself’ in the real and machines theory through the unknown. ‘Production as a process overflows all ideal categories and forms a cycle that relates itself to desire as an immanent principle.’ Cybernetics develops functionally, and not representationally: a ‘desiring machine, a partial object, does not represent anything’. Its semi-closed assemblages are not descriptions but programs, ‘auto’-replicated by way of an operation passing across irreducible exteriority. This is why cybernetics is inextricable from exploration, having no integrity transcending that of an uncomprehended circuit within which it is embedded, an outside in which it must swim. Reflection is always very late, derivative, and even then really something else. (294-5)”
Nick Land, Fanged Noumena: Collected Writings, 1987–2007