Sign in with Facebook
“i am retard,,,erghh,,,aaaa,,,,”
― The 48 Laws of Power
― The 48 Laws of Power
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Fanged Noumena: Collected Writings 1987 - 2007
― Fanged Noumena: Collected Writings 1987 - 2007
Ouroboros Gnostic Circle
— 56 members
— last activity Mar 09, 2017 11:18PM
A place to discuss the many forms of Gnostic theology and practices, especially as represented in our modern world. We are concerned first and foremos ...more
Anarchist & Radical Book Club
— 2697 members
— last activity Dec 18, 2025 01:03AM
This is a group to read and discuss anarchist practice and theory, by gathering a large body of anarchist literature, non-fiction, and theory, as well ...more
DJ’s 2025 Year in Books
Take a look at DJ’s Year in Books, including some fun facts about their reading.
Favorite Genres
Polls voted on by DJ
Lists liked by DJ
