Sign in with Facebook
“Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
― Fanged Noumena: Collected Writings 1987 - 2007
― Fanged Noumena: Collected Writings 1987 - 2007
“i am retard,,,erghh,,,aaaa,,,,”
― The 48 Laws of Power
― The 48 Laws of Power
Ouroboros Gnostic Circle
— 56 members
— last activity Mar 09, 2017 11:18PM
A place to discuss the many forms of Gnostic theology and practices, especially as represented in our modern world. We are concerned first and foremos ...more
Anarchist & Radical Book Club
— 2697 members
— last activity Dec 18, 2025 01:03AM
This is a group to read and discuss anarchist practice and theory, by gathering a large body of anarchist literature, non-fiction, and theory, as well ...more
DJ’s 2025 Year in Books
Take a look at DJ’s Year in Books, including some fun facts about their reading.
Favorite Genres
Polls voted on by DJ
Lists liked by DJ
