DJ Carcass > DJ's Quotes

Showing 1-2 of 2
sort by

  • #1
    “i am retard,,,erghh,,,aaaa,,,,”
    Robert Greene II, The 48 Laws of Power

  • #2
    Nick Land
    “Biovirus TA TA TA targets organisms, hacking and reprogramming ATGACTTATCCACGGTACATTCAGT cellular DNA to produce more virus virus virus virus virus virus virus virus. Its enzymic cut-and-past recombinant wetware-splicing crosses singularity when retroviral reverse-transcriptase clicks in (enabling ontogenetic DNA-RNA circuitry and endocellular computation).”
    Nick Land, Fanged Noumena: Collected Writings 1987 - 2007



Rss