The Song of the Cell: An Exploration of Medicine and the New Human

by Siddhartha Mukherjee

“Each cell leads a double life,” Schleiden would write a year later, “an entirely independent one, belonging to its own development alone; and an incidental one, in so far as it has become part of a plant.” A life within a life. An independent living being—a unit—that forms a part of the whole. A living building block contained within the larger living being.

Cancer, in short, is cell biology visualized in a pathological mirror.

“Do you remember coming into the hospital?” I asked. “No,” she said, looking out into the rain. “I only remember leaving.”

The transformation of medicine made possible by our new understanding of cell biology can be broadly divided into four categories. The first is the use of drugs, chemical substances, or physical stimulation to alter the properties of cells—their interactions with one another, their intercommunication, and their behavior. Antibiotics against germs, chemotherapy and immunotherapy for cancer, and the stimulation of neurons with electrodes to modulate nerve cell circuits in the brain fall in this first category. The second is the transfer of cells from body to body (including back into our own bodies), exemplified by blood transfusions, bone marrow transplantation, and in vitro fertilization (IVF). The third is the use of cells to synthesize a substance—insulin or antibodies—that produces a therapeutic effect on an illness. And most recently, there is a fourth category: the genetic modification of cells, followed by transplantation, to create cells, organs, and bodies endowed with new properties.

What is a cell, anyway? In a narrow sense, a cell is an autonomous living unit that acts as a decoding machine for a gene. Genes provide instructions—code, if you will—to build proteins, the molecules that perform virtually all the work in a cell. Proteins enable biological reactions, coordinate signals within the cell, form its structural elements, and turn genes on and off to regulate a cell’s identity, metabolism, growth, and death. They are the central functionaries in biology, the molecular machines that enable life.I Genes, which carry the codes to build proteins, are physically located in a double-stranded, helical molecule called deoxyribonucleic acid (DNA), which is further packaged in human cells into skein-like structures called chromosomes. As far as we know, DNA is present inside every living cell (unless it has been ejected from the cell). Scientists have hunted for cells that use molecules other than DNA to carry their instructions—RNA, for instance—but so far, they’ve never found an RNA instruction-carrying cell.

at its core, the pandemic, too, was a disease of cells. Yes, there was the virus, but viruses are inert, lifeless, without cells. Our cells had awoken the plague and brought it to life.

In The Emperor of All Maladies, I wrote about the aching quest to find cures for cancer or to prevent it. The Gene was propelled by the quest to decode and decipher the code of life. The Song of the Cell takes us on a very different journey: to understand life in terms of its simplest unit—the cell.

Hooke’s intelligence was phosphorescent and elastic, like a rubber band that glows as it stretches. He would enter disciplines and then expand and illuminate them as if by an internal light.

Atomistic claims are the most audacious of all: the scientist is proposing a fundamental reorganization of a world into unitary entities. Atoms. Genes. Cells. You have to think of a cell in a different manner: not as an object under a lens but as a functional site for all physiological chemical reactions, as an organizing unit for all tissues, and as the unifying locus for physiology and pathology. You have to move from a continuous organization of the biological world to a description that involves discontinuous, discrete, autonomous elements that unify that world. Metaphorically, we might say that you have to see past “flesh” (continuous, corporeal, and visible) to imagine “blood” (invisible, corpuscular, and discontinuous).

Omnis cellula e cellula: “From cells come cells.”

In the late 1830s, in Berlin, the German scientist Robert Remak looked at frog embryos and chicken blood under a microscope. He was hoping to capture the birth of a cell, a particularly rare event in chicken blood, and so he waited. And waited. And then, late one evening, he saw it: under his scope, he watched a cell quiver, enlarge, bulge, and split in two, giving rise to “daughter” cells. Nothing less than a jolt of euphoria must have shot up Remak’s spine, for he had found incontrovertible evidence that developing cells arose from the division of preexisting cells—Omnis cellula e cellula, as Raspail had so inconspicuously tucked into an epigraph.

The second debate that simmered through the early 1800s was preformation: the idea that the human fetus was already fully formed, albeit miniaturized, when it first appeared in the womb following fertilization.

In the mid-1830s, while François-Vincent Raspail was languishing in prison and Rudolf Virchow was still a struggling medical student, a young German lawyer named Matthias Schleiden had become frustrated with his profession. He tried, unsuccessfully, to put a bullet through his head but missed his mark. Chastened by his failure to shoot himself, Schleiden decided to abandon law and turn to his true passion: botany.

Gradually, as the reach and generality of their claim became evident, Schleiden and Schwann proposed the first two tenets of cell theory: All living organisms are composed of one or more cells. The cell is the basic unit of structure and organization in organisms.

The themes that had run through Virchow’s life had, thus far, been remarkably consistent: a restless, relentless inquisitiveness, and a skepticism about accepted wisdom and orthodox explanations.

In essence, Virchow had refined Schwann and Schleiden’s cell theory by adding three more crucial tenets to the two founding ones (“All living organisms are composed of one or more cells,” and “The cell is the basic unit of structure and organization in organisms”): All cells come from other cells (Omnis cellula e cellula). Normal physiology is the function of cellular physiology. Disease, the disruption of physiology, is the result of the disrupted physiology of the cell.

Virchow’s response, characteristically, was to reject accepted wisdom and to try to restrain the surging myth of racial division: in 1876, he began to coordinate a study of 6.76 million Germans to determine their hair color and skin tone. The results belied the mythology of the state. Only one in three Germans bore the hallmarks of Aryan superiority, while more than half was a mixture: some permutation of brown or white skinned, or blond or brown haired and blue eyed or brown eyed. Notably, 47 percent of Jewish children possessed a similar permutation of features, and a full 11 percent of Jewish children were blond and blue eyed—indistinguishable from the Aryan ideal. He published the data in the Archive of Pathology in 1886, three years before the birth of an Austrian-born German demagogue who would prove to be a master of myth building and would succeed, despite scientific data, to create races out of faces and utterly destroy the ideas of civility that Virchow had so radically advanced.

In a letter replying to a scientist who had asked him about the basis of illness, he identified the cell as the locus of pathology: “Every disease depends on an alteration of a larger or smaller number of cellular units in the living body, every pathological disturbance, every therapeutic effect, finds its ultimate explanation only when it’s possible to designate the specific living cellular elements involved.”

M.K. had been diagnosed with a particular variant of severe combined immunodeficiency (acronymed SCID), in which both B cells (white cells that make antibodies) and T cells (that kill microbially infected cells and help mount an immune response) are dysfunctional. A grotesque English garden of microbes—some common, some exotic—grew out of his blood: Streptococcus, Staphylococcus aureus, Staphylococcus epidermidis, weird fungal varieties, and rare bacterial species whose names I could not even pronounce. It was as if his body had been transformed into a living petri dish for microbes.

I also think of Rudolf Virchow, and the “new” pathology that he advanced. It isn’t sufficient to locate a disease in an organ; it’s necessary to understand which cells of the organ are responsible.

“Omne vivum ex vivo,” Redi wrote. “All life comes from life.”

Putrefaction, or rotting, was not caused by the inner decomposition of living creatures—or some visceral form of interior sin. Rather, decomposition only happened when these bacterial cells landed on the broth.

It remains an incredible, if inexplicable, lapse in the history of biology that, until 1876, no other scientist had experimented with transferring disease from one organism to the next in a systematic, scientific manner.

Louis Pasteur had assumed causality by association: the rotting of wine was associated with an overgrowth of bacteria; the putrefaction of broth was linked to its contact with microorganisms. Koch, in contrast, desired a more formal architecture of causality. First, he had isolated a microorganism from a diseased animal. Next, he’d demonstrated that introducing the pathogen into healthy animals caused the same disease. Then he’d re-isolated the microbe from inoculated animals, grown the organism again in pure form in a culture, and shown that it could re-create the disease.

Childbirth, in the nineteenth century, was almost as much life threatening as it was life giving.

In 1847, Semmelweis’s colleague Dr. Jacob Kolletschka cut himself with a scalpel while performing an autopsy. He was soon febrile and septic; Semmelweis could hardly help but notice that Kolletschka’s symptoms mirrored those of the women with childbed fever. Here, then, was a potential answer: the first clinic was run by surgeons and medical students who shuttled casually between the pathology department and the maternity ward—from performing cadaver dissections and autopsies straight to delivering babies. In contrast, the second clinic was run by midwives, who had no contact with cadavers and never performed autopsies. Semmelweis wondered if the students and surgeons, who routinely examined women without gloves, were transferring some material substance—“cadaverous material,” he called it—from the decomposing cadavers into a pregnant woman’s body.

As stunning as the results were, Semmelweis had no explanation that he could visualize. Was it blood? A fluid? A particle? Senior surgeons in Vienna didn’t believe in germ theory and had no interest in a junior assistant’s insistence that they wash their hands between the clinics. Semmelweis was harassed and ridiculed, passed over for a promotion, and eventually dismissed from the hospital. The idea that childbed fever was, in fact, a “doctor’s plague”—an iatrogenic, physician-induced disease—could hardly sit well with the professors of Vienna. He wrote increasingly frustrated and accusatory letters to obstetricians and surgeons all over Europe, all of whom dismissed Semmelweis as a crank. He eventually packed off to the backwaters of Budapest, only to suffer a mental breakdown. He was admitted to an asylum where the guards beat him, leaving him with broken bones and a gangrenous foot. Ignaz Semmelweis died in 1865, most likely of sepsis caused by the injuries; consumed, possibly, by germs—the very “material” substance that he had tried to identify as a cause of infections.

It occurs to me, as I write this, how much this framework—germs, cells, risk—still scaffolds the diagnostic art in medicine. Each time I see a patient, I realize, I am probing the cause of his or her disease through three elemental questions. Is it an exogenous agent, such as a bacterium or virus? Is there an endogenous disturbance of cellular physiology? Is it the consequence of a particular risk, be it exposure to some pathogen, a family history, or an environmental toxin?

Every cell on Earth—which is to say every unit of every living being—belongs to one of three entirely distinctive domains, or branches, of living organisms. The first branch comprises bacteria: single-celled organisms that are surrounded by a cell membrane, lack particular cellular structures found in animal and plant cells, and possess other structures that are unique to them. (It is precisely these differences that are the basis for the specificity of the antibacterial drugs mentioned above.)

An infectious disease specialist once told me that humans were just “nice-looking luggage to carry bacteria around the world.”

We—you and me—inhabit a second branch, or domain, called eukaryotes. The word eukaryote is a technicality: it refers to the idea that our cells, and the cells of animals, fungi, and plants, contain a special structure called a nucleus (karyon, or “kernel,” in Greek). This nucleus, as we will soon learn, is a storage site for chromosomes. Bacteria lack nuclei and are called prokaryotes—that is, “before nuclei.”

And now the third branch: archaea. It may be the singularly most startling fact in the history of taxonomy that this full branch of living beings remained undiscovered until about fifty years ago.

they’re the Cheshire cats of the living kingdom: absolutely essential to the full story, yet asserting “their presence only by their absence”—in other words, by the fact that they lack the defining features of the other two domains, partly because we’ve ignored studying them until recently.

The first cells—the simplest, most primitive of our ancestors—arose on Earth some 3.5 to 4 billion years ago, about 700 million years after the birth of the Earth. (That is a remarkably short period, if you think about it; only about a fifth of the history of the Earth had passed before living beings were already reproducing on it.)

Indeed, in lab experiments, simple chemicals, placed in conditions that resemble the atmospheric conditions on primitive Earth, and trapped within layers of clay, can give rise to precursors of RNA and even strands of RNA molecules.

But the transition from an RNA strand to a self-replicating RNA molecule is no small evolutionary feat. Most likely, two such molecules were needed—one to act as the template (i.e., the information carrier) and the other to make a copy of the template (i.e., a duplicator). When these two RNA molecules—template and duplicator—met each other, it was, perhaps, the most important and explosive evolutionary love affair in the history of our living planet. But the lovers had to avoid separation; if the two strands of RNA were to float away from each other, there would be no duplication and, by extension, no cellular life. And so some sort of structure—a spherical membrane—was likely needed to confine these components. These three components (a membrane, an RNA information carrier, and a duplicator) might have defined the first cell. If a self-replicating RNA system were bound by a spherical membrane, it would make more RNA copies within the confines of the sphere and grow in size by enlarging the membrane. At some point, biologists believe, the membrane-bound spheroid would split into two, each carrying the RNA duplicating system. (In lab experiments, Jack Szostak and his colleagues have shown that simple spheroidal structures, bound by membranes formed by fat molecules, can absorb more fat molecules, grow, and eventually split into two.) And from that point on, the protocell would launch its long evolutionary march toward the progenitor of the modern cell. Evolution would selec...

About 2 billion years ago (once again the exact date is a matter of debate), evolution took a strange and inexplicable turn. That is when a cell that is the common ancestor of human cells, plant cells, fungi cells, animal cells, and amoebal cells appeared on Earth.

We are, perhaps, life-come-lately, the sawdust left over from the carvings of the two main domains of life.

But there is one question that we will not and, perhaps, cannot answer. The origin of the modern cell is an evolutionary mystery. It seems to have left only the scarcest of fingerprints of its ancestry or lineage, with no trace of a second or third cousin, no close-enough peers that are still living, no intermediary forms. Lane calls it an “unexplained void… the black hole at the heart of biology.”

These, then, are among the first and most fundamental properties of the cell: autonomy, reproduction, and development.I

It is the membrane that defines the boundary; the outer limits of the self. Bodies are bound by a multicellular membrane: the skin. So is the psyche, by another membrane: the self. And so are houses and nations. To define an internal milieu is to define its edge—a place where the inside ends, and the outside begins. Without an edge, there is no self. To be a cell, to exist as cell, it must distinguish itself from its nonself.

Porosity, in short, represents an essential feature of life—but also an essential vulnerability of living. A perfectly sealed cell is a perfectly dead cell. But unsealing the membrane through portals exposes the cell to potential harm. The cell must embrace both: closed to the outside, yet open to the outside.

The protoplasm is a mind-bogglingly complex soup of chemicals. It is thick and colloidal in some places; watery in others.III It is the mother jelly that sustains life.

As you swim through the protoplasm, you are certain to encounter one particular molecule of critical importance: a long, strand-like molecule called ribonucleic acid or RNA. RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.VI You might imagine it as a set of instructions; a Morse code stretched along a tape. One particular RNA, freshly made in the cell’s nucleus, may arrive carrying the instructions to build, say, insulin. Other strands, encoding different proteins, might be floating by. How are these instructions decoded? Look left or right, and you’ll spot a massive macromolecular structure called a ribosome, a multipart assemblage first described by the Romanian American cell biologist George Palade in the 1940s. You can’t miss it: a liver cell, for instance, contains several million of them. The ribosome captures RNAs and decodes their instructions to synthesize proteins. This cellular protein factory is itself made of proteins and RNA. It is yet another of life’s fascinating recursions, in which proteins make it possible to make other proteins.

You might encounter yet another macromolecular structure, this one shaped like a tubular meat grinder. It is the cell’s trash compactor, the proteasome, where proteins go to die. Proteasomes degrade proteins into their constituents and eject the chewed-up pieces back into the protoplasm, completing the cycle of synthesis and breakdown.

As microscopists and cell biologists trained their eyes on cells with increasing precision, they found dozens of organized, functional substructures, analogous to organs—kidneys, bones, and hearts—that Vesalius and other anatomists had identified in the body. Biologists called them organelles: mini-organs found inside cells.

There is some debate about the origin of mitochondria. But one of the most intriguing, and widely accepted, theories is that more than a billion years ago, organelles were, in fact, microbial cells that developed the capacity to produce energy via a chemical reaction involving oxygen and glucose. These microbial cells were engulfed or captured by other cells and entered into a working partnership of sorts, a phenomenon termed endosymbiosis.

Mitochondria are found in all cells, but they are particularly densely packed in cells that need the most energy or that regulate energy storage, such as muscle cells, fat cells, and certain brain cells. They are wrapped around the tails of sperm, to provide them enough swimming energy to reach an egg.

Mitochondria possess their own genes and their own genomes, which, suggestively, bear some resemblance to the genes and genomes of bacteria—again supporting Margulis’s hypothesis that they were primitive cells that were engulfed by other cells and then became symbiotic with them.

How does a cell generate energy? There are two pathways: one fast and one slow. The fast route occurs mainly in the protoplasm of the cell. Enzymes serially break down glucose into smaller and smaller molecules, and the reaction produces energy. Because the process doesn’t use oxygen, it is called anaerobic. In terms of energy, the end product of the fast pathway is two molecules of a chemical called adenosine triphosphate, or ATP. ATP is the central currency of energy in virtually all living cells. Any chemical or physical activity that requires energy—for instance, the contraction of a muscle or the synthesis of a protein—utilizes, or “burns,” ATP. The deeper slow burn of sugars to produce energy occurs in mitochondria. (Bacterial cells, lacking mitochondria, can use only the first chain of reactions.) Here the end products of glycolysis (literally, the chemical breakdown of sugar) are fed into a cycle of reactions that ultimately produce water and carbon dioxide. This cycle of reactions involves the use of oxygen (and is therefore called aerobic) and is a small miracle of energy production: it generates a much larger harvest of energy, again, in the form of ATP molecules.