More on this book
Community
Kindle Notes & Highlights
Read between
February 18 - July 16, 2023
What is a cell, anyway? In a narrow sense, a cell is an autonomous living unit that acts as a decoding machine for a gene. Genes provide instructions—code, if you will—to build proteins, the molecules that perform virtually all the work in a cell. Proteins enable biological reactions, coordinate signals within the cell, form its structural elements, and turn genes on and off to regulate a cell’s identity, metabolism, growth, and death. They are the central functionaries in biology, the molecular machines that enable life.
Genes provide the code to build ribonucleic acid (RNA) that, in turn, is deciphered to build proteins. But aside from carrying the code to make proteins, some of these RNAs carry out diverse tasks in cells, some of which are yet to be deciphered. RNA can also regulate genes and function in concert with proteins in some biological reactions.
when I see a patient with an undiagnosable disease, I mumble quietly under my breath, recalling John Snow and my internist friend who liked to sniff patients. Germs. Cells. Risk.
In this sense, every antibiotic is a “cellular medicine”—a drug that relies on the distinctions between a microbial cell and a human cell.
Every cell on Earth—which is to say every unit of every living being—belongs to one of three entirely distinctive domains, or branches, of living organisms.
The first branch comprises bacteria: single-celled organisms that are surrounded by a cell membrane, lack particular cellular structures found in animal and plant cells, and possess other structures that are unique to them.
Bacteria are disturbingly, ferociously, uncannily successful. They dominate the cellular world.
We—you and me—inhabit a second branch, or domain, called eukaryotes.
our cells, and the cells of animals, fungi, and plants, contain a special structure called a nucleus (karyon, or “kernel,” in Greek). This nucleus, as we will soon learn, is a storage site for chromosomes.
the third branch: archaea. It may be the singularly most startling fact in the history of taxonomy that this full branch of living beings remained undiscovered until about fifty years ago. In the mid-1970s,
The journal Science described Woese as a “scarred revolutionary.” But decades later, we have largely accepted, validated, and vindicated his theory, so that archaea are now classified as a distinct, third domain of living creatures.
These, then, are among the first and most fundamental properties of the cell: autonomy, reproduction, and development.
RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.
The ribosome captures RNAs and decodes their instructions to synthesize proteins. This
Building proteins is one of the cell’s major tasks. Proteins form enzymes that control the chemical reactions of life. They create structural components of the cell. They are the receptors for signals from the outside. They form pores and channels across the membrane, and the regulators that switch genes on and off in response to stimuli. Proteins are the workhorses of the cell.
the cell’s trash compactor, the proteasome, where proteins go to die. Proteasomes degrade proteins into their constituents and eject the chewed-up pieces back into the protoplasm, completing the cycle of synthesis and breakdown.
As microscopists and cell biologists trained their eyes on cells with increasing precision, they found dozens of organized, functional substructures, analogous to organs—kidneys, bones, and hearts—that
Biologists called them organelles: mini-organs found inside cells.
kidney-shaped organelle first described, albeit vaguely, in animal cells in the 1840s by a German histologist named Richard Altmann. These organelles, later renamed mitochondr...
This highlight has been truncated due to consecutive passage length restrictions.
Mitochondria are found in all cells, but they are particularly densely packed in cells that need the most energy or that regulate energy storage, such as muscle cells, fat cells, and certain brain cells.
Mitochondria possess their own genes and their own genomes,
How does a cell generate energy? There are two pathways: one fast and one slow. The fast route occurs mainly in the protoplasm of the cell. Enzymes serially break down glucose into smaller and smaller molecules, and the reaction produces energy. Because the process doesn’t use oxygen, it is called anaerobic. In terms of energy, the end product of the fast pathway is two molecules of a chemical called adenosine triphosphate, or ATP.
ATP is the central currency of energy in virtually all living cells. Any chemical or physical activity that requires energy—for instance, the contraction of a muscle or the synthesis of a protein—utilizes, or “burns,” ATP.
The deeper slow burn of sugars to produce energy occurs in mitochondria. (Bacterial cells, lacking mitochondria, can use only the first chain of reactions.) Here the end products of glycolysis (literally, the chemical breakdown of sugar) are fed into a cycle of reactions that ultimately produce water and carbon dioxide. This cycle of reactions involves the use of oxygen (and is therefore called aerobic) and is a small mi...
This highlight has been truncated due to consecutive passage length restrictions.
The whole process can be imagined as an elaborate postal system. It begins with the linguistic code of genes (RNA) that is translated to write the letter (the protein). The protein is written, or synthesized, by the cell’s letter writer (the ribosome), which then posts it to the mailbox (the pore by which the protein enters the ER). The pore routes it to the central posting station (the endoplasmic reticulum), which then sends the letter to the sorting system (the Golgi), and finally brings it to the delivery vehicle (the secretory granule). There are, in fact, even codes appended to proteins
...more
the nucleus is where the bulk of the cell’s genetic material, the instruction manual for life, is stored. It is the storage bank for DNA, for the genome.
RNA, the code to build proteins, is copied from the genetic code here and then exported out of the nucleus. We might imagine the nucleus as the center of the center of life.
The nucleus, as I mentioned before, houses the organism’s genome, made of long stretches of deoxyribonucleic acid.
Proteins, traversing the cytoplasm, enter through the pores of the nuclear membrane and bind to the DNA and turn genes on and off. Hormones, bound to proteins, traffic in and out. ATP, the universal source of energy, moves swiftly through the pores.
The process of switching genes on and off is vital, giving the cell its identity. The set of on/off genes instructs a neuron to be a neuron, and a white cell to be a white cell.
During the development of an organism, genes—or rather proteins encoded by genes—tell cells about their relative positions and command their future fates. Genes are turned on and off by external stimuli such as ...
This highlight has been truncated due to consecutive passage length restrictions.
Mitochondrial mutations are special because they can be inherited only from your mother, while most other mutations can come from either parent. Mitochondria don’t have an autonomous existence; they can live only inside cells. They divide when a cell divides and then are apportioned to the two daughter cells. When an egg cell forms in the mother, all its mitochondria are from her cells. Upon fertilization, the sperm cell injects its DNA into the egg—but not any mitochondria. Therefore, every mitochondrion that you are born with is maternal in origin.
In humans and multicellular organisms, the process for the production of new cells to build organs and tissues is called mitosis—from mitos, the Greek word for “thread.” In contrast, the birth of new cells, sperm, and eggs for the purpose of reproduction—to make a new organism—is called meiosis, from meion, the Greek word for “lessening.”
Since the chromosomes doubled at first and then halved upon cell division, the number of chromosomes in the daughter cells was conserved. Forty-six became ninety-two, and was halved to forty-six.
The genesis of sperm and eggs, then, must require first halving the number of chromosomes, twenty-three each, and then restoring them back to forty-six upon fertilization.
Humans, starting with forty-six chromosomes in every bodily cell, produce sperm cells in the testes and egg cells in the ovaries via meiosis, each ending up with twenty-three chromosomes. When sperm and egg meet to form a zygote, the number of chromosomes is restored to forty-six.
As the organism matures, it eventually develops a gonad (testes or ovaries), with forty-six chromosomes in each cell. And here the game shifts again: when the cells in the gonads make male and female reproductive cells, they undergo meiosis, generating sperm and eggs with twenty-three chromosomes each. Fertilization restores the number to forty-six.
Medical and scientific societies around the world are currently scrambling to establish rules and standards to govern human gene editing in embryos.
There is an interplay between intrinsic signals, encoded by genes within cells, and extrinsic signals induced by surrounding cells. The extrinsic signals (proteins and chemicals) reach the recipient cells and activate or repress genes in them.
We began with the discovery of cells: their structure, their physiology, their metabolism, their respiration, and their inner anatomy. We journeyed, if briefly, into the world of single-celled microbes and the transformative effect of that discovery on medicine: antisepsis, and the eventual discovery of antibiotics. We next encountered cell division: the production of new cells from existing cells (mitosis) and the genesis of cells for sexual reproduction (meiosis). We witnessed the identification of the four phases of cell division (G1, S, G2, M), the characterization of its crucial
...more
our understanding of cell division is transforming cancer medicine and in vitro fertilization (IVF), and how reproductive technologies, coupled with cell biology, have forced us to enter the ethically unfamiliar landscape of interventions on human embryos.
hemoglobin carried iron, and the iron, in turn, bound oxygen, the molecule responsible for cellular respiration.
The principal purpose of the red blood cell was to ferry oxygen, bound to hemoglobin, to tissues in all the body’s organs.
In addition to cells, plasma, the fluid component of blood, carries other materials crucial to human physiology: carbon dioxide, hormones, metabolites, waste products, nutrients, clotting factors, and chemical signals.
Serum differs from plasma: it is the fluid that’s left over after blood has been clotted. It contains proteins, including antibodies, but no cells.
In common parlance, the four groups came to be known as A, B, O (universal donors), and AB (universal acceptors).
positive (denoting the presence of an inherited protein called Rhesus-factor on the surface of red blood cells) and Rh-negative (indicating a lack of Rh-factor), for determining compatibility within each group: A+, B-, AB-, and so forth.
The addition of a simple salt found in lime juice, sodium citrate, kept blood from coagulating, prolonging its storage.
In 1881, the Italian pathologist and microscopist Giulio Bizzozero found that human blood carried minuscule fragments of cells—tiny, shorn-up pieces, barely visible but always present.
Bizzozero recognized them as an independent component of blood.
