The Song of the Cell: An Exploration of Medicine and the New Human

by Siddhartha Mukherjee

A life within a life. An independent living being—a unit—that forms a part of the whole. A living building block contained within the larger living being.

We were a sum of parts. The discovery of cells, and the reframing of the human body as a cellular ecosystem, also announced the birth of a new kind of medicine based on the therapeutic manipulations of cells. A hip fracture, cardiac arrest, immunodeficiency, Alzheimer’s dementia, AIDS, pneumonia, lung cancer, kidney failure, arthritis—all could be reconceived as the results of cells, or systems of cells, functioning abnormally. And all could be perceived as loci of cellular therapies.

The transformation of medicine made possible by our new understanding of cell biology can be broadly divided into four categories. The first is the use of drugs, chemical substances, or physical stimulation to alter the properties of cells—their interactions with one another, their intercommunication, and their behavior. Antibiotics against germs, chemotherapy and immunotherapy for cancer, and the stimulation of neurons with electrodes to modulate nerve cell circuits in the brain fall in this first category. The second is the transfer of cells from body to body (including back into our own bodies), exemplified by blood transfusions, bone marrow transplantation, and in vitro fertilization (IVF). The third is the use of cells to synthesize a substance—insulin or antibodies—that produces a therapeutic effect on an illness. And most recently, there is a fourth category: the genetic modification of cells, followed by transplantation, to create cells, organs, and bodies endowed with new properties.

In a sense, then, one might define life as having cells, and cells as having life.

What is a cell, anyway? In a narrow sense, a cell is an autonomous living unit that acts as a decoding machine for a gene. Genes provide instructions—code, if you will—to build proteins, the molecules that perform virtually all the work in a cell. Proteins enable biological reactions, coordinate signals within the cell, form its structural elements, and turn genes on and off to regulate a cell’s identity, metabolism, growth, and death. They are the central functionaries in biology, the molecular machines that enable life.

put more simply, a gene carries the code; a cell deciphers that code. A cell thus transforms information into form; genetic code into proteins. A gene without a cell is lifeless—an instruction manual stored inside an inert molecule, a musical score without a musician, a lonely library with no one to read the books within it. A cell brings materiality and physicality to a set of genes. A cell enlivens genes.

(if cloudless Italy was a land made for telescopes, then foggy, dark England seemed custom-made for microscopes)—and

In the history of biology, there are often valleys of silence that follow the peaks of monumental discoveries.

Science in general

Vitalists had no problem with cells per se. As they saw it, a divine Creator fashioning the entire repertoire of biological organisms over the course of six days may well have chosen to construct them out of unitary blocks (how much easier it is to build an elephant and a millipede out of the same blocks, especially if you have a rush order with just six days to deliver the goods).

In essence, Virchow had refined Schwann and Schleiden’s cell theory by adding three more crucial tenets to the two founding ones (“All living organisms are composed of one or more cells,” and “The cell is the basic unit of structure and organization in organisms”): All cells come from other cells (Omnis cellula e cellula). Normal physiology is the function of cellular physiology. Disease, the disruption of physiology, is the result of the disrupted physiology of the cell. These five principles would form the pillars of cell biology and cellular medicine.

In a letter replying to a scientist who had asked him about the basis of illness, he identified the cell as the locus of pathology: “Every disease depends on an alteration of a larger or smaller number of cellular units in the living body, every pathological disturbance, every therapeutic effect, finds its ultimate explanation only when it’s possible to designate the specific living cellular elements involved.”

Like hermits, microbes need only be concerned with feeding themselves; neither coordination nor cooperation with others is necessary, though some microbes occasionally join forces. In contrast, cells in a multicellular organism, from the four cells in some algae to the thirty-seven trillion in a human, give up their independence to stick together tenaciously; they take on specialized functions, and they curtail their own reproduction for the greater good, growing only as much as they need to fulfill their functions. When they rebel, cancer can break out.

Pasteur insisted that, by repeated culture in the lab, bacterial cells could be weakened in their ability to cause disease, or, in the jargon of biology, attenuated. Pasteur intended to use attenuated anthrax as a vaccine: the weakened bacteria would strengthen immunity but not cause disease.

Each time I see a patient, I realize, I am probing the cause of his or her disease through three elemental questions. Is it an exogenous agent, such as a bacterium or virus? Is there an endogenous disturbance of cellular physiology? Is it the consequence of a particular risk, be it exposure to some pathogen, a family history, or an environmental toxin?

Penicillin kills the bacterial enzymes that synthesize the cell wall, resulting in bacteria with “holes” in their walls. Human cells don’t possess these particular kinds of cell walls, thereby making penicillin a magic bullet against bacterial species that rely on the integrity of their cell walls.

Every potent antibiotic—doxycycline, rifampin, levofloxacin—recognizes some molecular component of human cells that is different from a bacterial cell. In this sense, every antibiotic is a “cellular medicine”—a drug that relies on the distinctions between a microbial cell and a human cell. The more we learn about cell biology, the subtler distinctions we uncover, and the more potent antimicrobials we can learn to create.

Before we leave antibiotics and the microbial world, let’s dwell for a moment on distinctions. Every cell on Earth—which is to say every unit of every living being—belongs to one of three entirely ...

An infectious disease specialist once told me that humans were just “nice-looking luggage to carry bacteria around the world.” He might have been right.

The word eukaryote is a technicality: it refers to the idea that our cells, and the cells of animals, fungi, and plants, contain a special structure called a nucleus (karyon, or “kernel,” in Greek). This nucleus, as we will soon learn, is a storage site for chromosomes. Bacteria lack nuclei and are called prokaryotes—that is, “before nuclei.” Compared with bacteria, we are fragile, feeble, finicky beings capable of inhabiting vastly more limited environments and restricted ecological niches.

In the mid-1970s, Carl Woese, a professor of biology at the University of Illinois at Urbana-Champaign, used comparative genetics—the comparison of genes across various organisms—to deduce that we had misclassified not just some arcane microbe but rather an entire domain of life.

When these two RNA molecules—template and duplicator—met each other, it was, perhaps, the most important and explosive evolutionary love affair in the history of our living planet. But the lovers had to avoid separation; if the two strands of RNA were to float away from each other, there would be no duplication and, by extension, no cellular life. And so some sort of structure—a spherical membrane—was likely needed to confine these components.

These three components (a membrane, an RNA information carrier, and a duplicator) might have defined the first cell. If a self-replicating RNA system were bound by a spherical membrane, it would make more RNA copies within the confines of the sphere and grow in size by enlarging the membrane.

New evidence suggests that this “modern” eukaryotic cell arose within archaea. In other words, life has only two principal domains—bacteria and archaea—and eukaryotes (“our” cells) represent a relatively recent sub-branch of archaea. We are, perhaps, life-come-lately, the sawdust left over from the carvings of the two main domains of life.

But there is one question that we will not and, perhaps, cannot answer. The origin of the modern cell is an evolutionary mystery. It seems to have left only the scarcest of fingerprints of its ancestry or lineage, with no trace of a second or third cousin, no close-enough peers that are still living, no intermediary forms. Lane calls it an “unexplained void… the black hole at the heart of biology.”

first it has evolved to be autonomous, to survive as an independent living unit. This autonomy depends, in turn, on organization—on the cell’s interior anatomy. A cell is not a blob of chemicals; it has distinct structures, or subunits, within it that allow it to function independently. The subunits are designed to supply energy, discard waste, store nutrients, sequester toxic products, and maintain the internal milieu of a cell. Second, a cell is designed to reproduce, so that one cell can produce all the other cells that populate the organism’s body. And finally, for multicellular organisms, the cell (or at least the first cell) is designed to differentiate and develop into other specialized cells, so that various parts of the body—tissues, organs, organ systems—can be formed.

These, then, are among the first and most fundamental properties of the cell: autonomy, reproduction, and development.I

Every such opening is an exception to the rule of integrity; after all, a doorway to the outside is also a doorway to the inside. Viruses or other microbes might use the routes of nutrient uptake or waste disposal to enter a cell. Porosity, in short, represents an essential feature of life—but also an essential vulnerability of living. A perfectly sealed cell is a perfectly dead cell. But unsealing the membrane through portals exposes the cell to potential harm. The cell must embrace both: closed to the outside, yet open to the outside.

cell membrane must have two layers of lipids. It is a lipid bilayer. Imagine, for a moment, two sheets of paper glued together back-to-back and then shaped into a three-dimensional object—a

The final piece of the puzzle—how molecules such as sugar or ions pass in and out of the lipid bilayer, and how the cell communicates with its outside—was solved in 1972, nearly fifty years after Gorter and Grendel’s experiments. Two biochemists, Garth Nicolson and Seymour Singer, proposed a model in which proteins were embedded, like hatches, or channels, crossing the cell membrane. The lipid bilayer was not uniform or monotonous; it was porous by design. Proteins, floating in the membrane and spanning from inside to outside, allowed molecules to permeate the membrane and allowed other proteins and molecules to bind to the outside of the cell.

RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.VI You might imagine it as a set of instructions; a Morse code stretched along a tape. One particular RNA, freshly made in the cell’s nucleus, may arrive carrying the instructions to build, say, insulin. Other strands, encoding different proteins, might be floating

There is some debate about the origin of mitochondria. But one of the most intriguing, and widely accepted, theories is that more than a billion years ago, organelles were, in fact, microbial cells that developed the capacity to produce energy via a chemical reaction involving oxygen and glucose. These microbial cells were engulfed or captured by other cells and entered into a working partnership of sorts, a phenomenon termed endosymbiosis.

Mitochondria possess their own genes and their own genomes, which, suggestively, bear some resemblance to the genes and genomes of bacteria—again supporting Margulis’s hypothesis that they were primitive cells that were engulfed by other cells and then became symbiotic with them.

The combination of the fast and slow burn nets about the equivalent of thirty-two ATP molecules from every molecule of glucose.

Over the course of a day, we generate billions of little canisters of fuel, to fire a billion little engines, in the billions of cells in our bodies. “Should all the billions of gently burning little fires cease to burn,” the physical chemist Eugene Rabinowitch wrote, “no heart could beat, no plant could grow upward defying gravity, no amoeba could swim, no sensation could speed along a nerve, no thought could flash in the human brain.”

The whole process can be imagined as an elaborate postal system. It begins with the linguistic code of genes (RNA) that is translated to write the letter (the protein). The protein is written, or synthesized, by the cell’s letter writer (the ribosome), which then posts it to the mailbox (the pore by which the protein enters the ER). The pore routes it to the central posting station (the endoplasmic reticulum), which then sends the letter to the sorting system (the Golgi), and finally brings it to the delivery vehicle (the secretory granule). There are, in fact, even codes appended to proteins (stamps) that enable the cell to determine their ultimate destination. This “postal system,” Palade realized, is how most proteins get to their correct locations within the cell.

the nucleus is where the bulk of the cell’s genetic material, the instruction manual for life, is stored. It is the storage bank for DNA, for the genome.

“1 1 7 7 8,” Jared wrote in his diary. “I wish this had been the combination to my hockey locket, or bike lock, or even to my school locker. Instead, it was to be the combination to a genetic mutation at nucleotide position 11778 that would unlock the disease in my body at the age of eleven and would ultimately change my life forever…. Blind, what the hell was blind? I’m eleven years old. I’m a hockey player. I dig chicks, and they dig me. I’ve got a lot of friends and no worries. Blind? What do they mean I won’t be able to see? Not be able to see what?… Just fix it, Dad, and let me go play with my buddies.”

In humans and multicellular organisms, the process for the production of new cells to build organs and tissues is called mitosis—from mitos, the Greek word for “thread.” In contrast, the birth of new cells, sperm, and eggs for the purpose of reproduction—to make a new organism—is called meiosis, from meion, the Greek word for “lessening.”

It is easy, in retrospect, to understand that the dynamics of this form of cell division could not possibly be the same as that of mitosis: it’s a matter of elementary mathematics. In mitosis, you’ll recall, the parent cell and the daughter cells end up with the same number of chromosomes. You start, say, with forty-six (the number of chromosomes in human cells); the chromosomes duplicate (ninety-two), and then each daughter cell gets half: back to forty-six.

The genesis of sperm and eggs, then, must require first halving the number of chromosomes, twenty-three each, and then restoring them back to forty-six upon fertilization. This variant of cell division—reduction, followed by restoration—was observed in sea urchins by Theodor Boveri and Oscar Hertwig in the mid-1870s. In 1883, Belgian zoologist Édouard van Beneden also observed meiosis in worms, confirming the commonality of the process in more complex organisms.

Cas9, when combined with a piece of RNA to guide it, can be directed to make a deliberate change in the human genome. You can analogize it to finding and erasing one word in one sentence on one page in one volume of that eighty-thousand-book library.

the genetic manipulation of the human embryo to arrest diseases (or, perhaps, to enhance human abilities) seems, every day, to become an inevitable destination for medicine. What began as a treatment for human infertility is now being repurposed as a therapy for human vulnerability. And at the center of this therapy lies an increasingly malleable and increasingly precious cell: the fertilized egg cell, the human zygote.

Take a yeast cell or some species of single-celled algae. These single cells, or modern cells, as biologist Nick Lane calls them, possess virtually all the features of the cells of vastly more complex organisms, including humans. They are abundant, fiercely successful in their environments, and can thrive in diverse places on Earth. They communicate with one another, reproduce, metabolize, and trade signals. They possess nuclei, mitochondria, and most of the cellular organelles that make an autonomous cell function with extraordinary efficiency. Which begs another question: Why on earth did they choose to form multicellular organisms?

Evolution ? But what was the marginal advantage

But the reigning theories suggest that specialization and cooperativity conserve energy and resources while allowing new, synergistic functions to develop. One part of the collective can handle waste disposal, for instance, while another acquires food—and thus the multicellular cluster acquires an evolutionary edge. One prominent hypothesis, bolstered by experiments and mathematical modeling, suggests that multicellularity evolved to support larger sizes and rapid movement, thereby enabling the organism to escape predation (it’s hard to swallow a snowflake-sized body) or to make faster, coordinated movements toward weak gradients of food. Evolution raced toward collective existence because “organisms” could race away from being eaten—or, equally, race toward eating. The answer may be unknowable, or perhaps there are many answers. What we do know is that the evolution of multicellularity was not an accident, but purposeful and directional.

The next series of events represents the true marvel of embryology. The tiny cluster of cells hanging from the walls of the cellular balloon, the inner cell mass, divides furiously and begins to form two layers of cells—the outer one called the ectoderm, and the inner called the endoderm. And about three weeks after conception, a third layer of cells invades the two layers and lodges itself between them, like a child squeezing into bed between her parents. It’s now the middle layer, called the mesoderm. This three-layered embryo—ectoderm, mesoderm, endoderm—is the basis of every organ in the human body.

The ectoderm will give rise to everything that faces the outer surface of the body: skin, hair, nails, teeth, even the lens of the eye. The endoderm produces everything that faces the inner surface of the body, such as the intestines and the lungs. The mesoderm handles everything in the middle: muscle, bone, blood, heart.

Early-developing cells such as the organizer cells secrete local factors that make late-developing cells fix their fates and forms, and these cells, in turn, secrete factors that create organs and the connections between organs.IV The growth of an embryo is a process, a cascade. At each stage, preexisting cells release proteins and chemicals that tell the newly emerging and newly migrating cells where to go and what to become. They command the formation of other layers and, later, the formation of tissues and organs. And the cells within these layers themselves turn genes on and off, in response to location and their intrinsic properties, to obtain their self-identities.

There is an interplay between intrinsic signals, encoded by genes within cells, and extrinsic signals induced by surrounding cells. The extrinsic signals (proteins and chemicals) reach the recipient cells and activate or repress genes in them. They also interact with one another: cancelling or amplifying their actions, ultimately leading cells to adopt their fates, positions, connections, and locations. This is how we build our cellular house.

Is it that “natural” processes that have evolved untouched since the birth of humans are part of the past, while “tampering” with the developing cell is our inevitable future?

These debates—the manipulation of reproduction and development, or of embryos to change their genes—are ricocheting around the globe as I write this (and I wrote extensively about the promises as well as the perils of these technologies in The Gene). The arguments won’t be resolved easily, for they impinge not just on the fundamental features of cells, but also on the fundamental features of humans. The only way to find a reasonable answer, or even a compromise, lies in a continuous engagement with evolving debate about the limits of scientific intervention, and the advancing front of cellular technologies. Every human is a stakeholder in this debate. It involves the one, the many, and the “many many.”