Deborah J. Ross's Blog, page 113

Perfectionism in Motherhood, Cooking, and Writing

"As a child, my family's menu consisted of two choices: take it or leave it." -- Buddy Hackett

Just about everyone who reads this smiles, but actually I think they should be screaming. Either/or choices and black-and-white thinking serve none of us well. Either you get an A+ or you are a total failure. Your book is either #1 on the New York Times Bestseller list and wins both the Nebula and Hugo Awards, or it is an abysmal flop. Your marriage is either the stunning example to all humankind or it's crap. Exaggerated like that, it's easy to see the ridiculousness of perfection-or-nothing. But how many times do we see ourselves and our lives through a perfection-tinted lens?

Years ago, when my children were small, I agonized over my many, many lapses in maternal perfection. At times, I was sure that a single moment of inattention or crabbiness had ruined my beautiful babies forever. A friend (who, interestingly enough, was childless herself) gave me a book in which I read that it isn't necessary to be a perfect mother, only a good-enough mother. Was I good enough? Even in my darkest moments, I knew that I was. For all the black marks, I could look at a thousand more times of games played, books read aloud, lullabies sung, trips to the zoo, mommy and me classes in everything from gymnastics to piano, walks along the beach... (And my daughters have grown up to be amazing, strong women, for which I take an eensy amount of credit, the rest being all their doing.)

I've also learned to relax about my cooking. I'm a good cook, although not given to following recipes too closely or attempting anything too fancy. My general approach is to grab a bunch of fresh produce, mostly from our garden, and not overcook it. But from time to time, the results might be edible but are unlikely to be requested again. Then there are the spectacular disasters. I am notorious for burning things in pots, which is what happens when plot ideas strike in the middle of preparing dinner. My best weapon against perfectionism here is a sense of humor. If I can laugh at the inedibility of an experiment (and follow it up with a 30-minute-or-less-from-pantry-staples dish) then it becomes a shared source of merriment. Silly, rather than tragic.

Why then is it so much harder to cut myself some slack when it comes to writing? In my saner moments, I know that no piece of prose is ever perfect. It works or doesn't work or sort-of works or works for some folks but not others. We say "perfect" when it carries us away so completely, we are oblivious to any flaws. But the flaws are there, and another reader (or viewer, or listener) might well find them looming large.

What would it take for me to say, "This is the best I can do right now"? To remember that, as Paul Valery wrote, "a poem is never finished, only abandoned."

Can I trust my creative instincts to know when to let a project rest and come back to it later, when to keep working away, or when to release it to the world, warts and all?

Paris, Grief, and Healing

Lots of folks have posted on the recent terrorist attack in Paris. I don't have much to add, but I do feel moved to re-post some thoughts from years ago, about 9/11 and the anniversary of my mother's murder, also in September. A few of the references are dated, but the process of coming to terms with trauma remains valid for me.








What has changed for me this year is that I have begun to work for the abolition of the death penalty. Speaking only for myself, I see strong parallels between a murder victim family seeking this form of revenge and the vilification of the Muslim community concurrent with the invasion of Iraq. Of course, justice is desirable. Criminal acts call for appropriate consequences. I would never say that it’s okay for my mother’s killer to walk the streets or that those responsible for the 9/11 attacks should not be prosecuted according to law. Setting aside the politics of that invasion and the problems with the application of capital punishment, however, my concern is with whether retaliative actions help or hinder the recovery of the survivors.

My own experience is that revenge does not. I want to emphasize that I do not speak for anyone else. We all have different experiences. For me, focusing on wishing harm to the one who had harmed my mother might well have kept me locked — incarcerated — in a state of bitterness and hatred. While I was in no way to blame for what happened, I still bear the responsibility for what I do with it. It’s like the adult child of an alcoholic getting herself into therapy instead of whining helplessly, attributing all her problems to her upbringing.

I have to ask myself, What do I need? What do I want? One of my inspirations was a woman of astonishing kindness and grace, whose daughter and son-in-law were murdered and whose bodies she discovered. She told me that she faced a choice of whether or not to let herself be driven crazy by what she experienced. I think we all have that choice — to succumb to the darkness of our anguish and righteous fury, or to walk through it, to move beyond it.

I remember the scene in The Princess Bride where Inigo Montoya finally tracks down Count Rugen, who begs for his life and offers anything. Inigo says, “I want my father back!” (and then kills him). I want my mother back, too. All those who lost loved ones and colleagues want them back. We know that’s impossible, but what is possible is to get our own lives back. Our own selves. Our best selves.

My experience of healing is that I get myself back when I focus on re-engaging with life, on fully experiencing my feelings, on understanding what I have lost and what can never be replaced, but what can be restored. The more I stop looking to an external event (the execution of the murderer) to somehow make me feel better or “achieve closure,” and instead focus on taking care of my insides — my heart, my spirit, my body — the better I fare.

So I’ve been talking about my own healing process and what I’ve learned. I’ve been meeting with other family members and with people who’ve been sentenced to death and then exonerated. I’ve been looking for ways to build bridges, to nourish tolerance and reconciliation, to create understanding. I make an ongoing conscious decision to not harbor hatred in my heart, but to fill it instead with what I want in my life.

Love. Compassion. Gratitude. Joy. Wonder. Peace.

I can think of no more fitting memorial for my mother . . . or for those who died on 9/11.

Writerly Support Goes Both Ways

Some years ago, I struck up a conversation with a young writer at a convention. (I love getting to know other writers, so this is not unusual for me.) One thing led to another, led to lunch, led to getting together on a regular basis, led to frequently chatting online. I cheered her on as she had her first professional sale, and then another, and then a cover story on a prestigious magazine. One of the gifts of such a relationship is not the support I receive from it, but the honor and joy of watching someone else come into her own as an artist, to celebrate her achievements. It's the opposite of Schaudenfreude -- it's taking immense pleasure and pride in the success of someone you have come to care about.

I've written about these lunches here: The Lady (Actual and Honorary) Writers' Lunch


I find such friendships invaluable, and even more so when they shift from "pro/newbie" to one of true peers. Although we may not be in the same place in terms of professional publication, we each bring a wealth of life experiences to the conversation. Often, critical skills develop faster than writing craft, so even a novice writer can provide invaluable feedback.Trust arises from recognition of each other's strengths.
This happened recently, when I was wrestling with the opening of a new novel. I typed "Chapter 1" and then stared at the blank screen. Everything I could come up with for a beginning sentence was -- to put it mildly, just awful. I wouldn't want to read a book that began that way. But because my friend and I were IMing and she often shares thoughts about her creative process and struggles with various aspects of storytelling in a very different style than mine, I felt safe with her. She agreed that my idea wasn't very entrancing (she was very nice about it, for she understands that beginnings are vulnerable times and that this is indeed a process, not the final copy on the editor's desk). Her support lightened the burden of "I'm totally useless and now everyone is going to find out; I'll never write another decent sentence in my life and I have no idea how to begin a novel!" which we both knew to be not true, but the sort of self-doubt that regularly assails writers of all skill levels.
Eventually I calmed down enough to remember one of my tried and true techniques for coming up with titles. I write down every one I can think of, quite quickly so that I get through all the really stupid ones first. I give myself permission to be ridiculous -- and silly -- and quirky -- and by this time, I am usually generating stuff that has some potential. I did the same thing with opening lines, and before long I realized I'd become ensnared by one of my perennial challenges: wrong point of entry. By backing up (in this case) or leaping forward, I can find the place that clicks. 
I went to bed, having written a page or so, and woke up with: "Yes, and this other thing happens and then she gets thrown into jail (on page 2 or 3) and by the time she gets bailed out, her father has been brainwashed..." Okay, this has possibilities!
Thanks, dear friend, for cheering me on through the discouraging part!

Today's Work

I just typed:
THE LARAN GAMBIT: A DARKOVER NOVEL
Chapter 1


Now comes the hard part! Or the fun part, as I like to think of it!

How I Became a Reader

Over on the Book View Cafe blog, Sherwood Smith describes her journey as a "passionate reader" (her phrase). She writes how a babysitter brought over a book that ignited that passion:

The story was everything I wanted: kids with no parents, girls getting to adventure as much as boys, no drippy patriotic or moral message in that inimical fifties way of “do what I say, but if you do what I do you’ll be in trouble,” funny stuff as well as action.

I suppose every one of us who loves books has a story. Here are some tidbits from mine. I'd love to hear yours, as well.

I am of an age when kids were expected to learn to read at school, usually in 2nd grade or so. Also, for some reason, I never went to kindergarten (and no one I knew went to preschool, not that my family could have afforded it). I got dumped into first grade with no prior school experience and spent the next couple of years absolutely confused. Reading was opaque to me. I remember struggling with the word "laugh." I just could not translate those letters into anything like a familiar word.

Then in the summer between 2nd and 3rd grades, I was given a discarded reader (3rd grade, I think). I remember the brightly colored pictures and stories I wanted to gobble up. The fairy tale about the hill of glass, and excerpts from books like Understood Betsy (the chapter where she and Molly get left behind at the fair and have to make their way home). These memories are mixed with the rocking chair in which I sat and the sun streaming through my bedroom window. I learned to read that summer because reading gave me entry into wonderful worlds, places I wanted to be, and people I wanted to know more about. I dove into the books on my own shelves. I think that by the time I entered 3rd grade, I was reading and a 5th or 6th grade level.

So what did I read in 5th and 6th grade?

Anything I could get my hands on!

By this time, I was checking out library books and snatching books from the shelves of the classrooms. I read Black Beauty and Robinson Crusoe and Treasure Island  and Stuart Little and Dr. Seuss. And anything with horses or dogs in it: The Black Stallion and the Albert Payson Terhune books featuring collies (Lassie -- the original version with Roddy MacDowell -- was very popular). It wasn't until high school that I tackled Crime and Punishment and then discovered Andre Norton, my gateway drug into fantasy and science fiction.

I don't remember how I came by that reader, but I am so grateful to whoever it was.

How and when did you fall in love with books?

World Fantasy Awards and Jackson's Middle Earth

First and foremost, congratulations to the winners of the World Fantasy Award, and also to the finalists. Many splendid creations here.

Now this post will veer off in a highly personal direction, applying to no one but myself. I have read one of the winners and when I saw the title, I felt a little sick. Do not get me wrong -- the work absolutely deserved the award. It was highly original and superbly executed, a stellar addition to the field.

And it gave the the absolute shakes. There's no way I can see myself ever reading it again. Our local library got my copy.

I've talked with folks who write and love horror about my aversion to it, and I appreciate their point that horror gives us a way of regaining power over the things that terrify us. Once upon a time, I got a delicious thrill out of that adrenaline jolt and the weird, fascinating dark stuff. I don't anymore. I think my threshold has been permanently re-set, and the consequences of exceeding it are more tenacious.

So why am I not pushed over that edge by the violence in the Peter Jackson Middle Earth films? There's plenty of excitement and twenty ways to kill an orc, each sillier and bloodier than the one before, and characters I love in dire peril. Is it the fantastical setting? The characters, even non-humans like Elves and Dwarves, don't feel unreal. Is it the knowledge that all will be well in the end, or as well as can be, given the price various characters play? I still cry at Boromir's death -- he didn't have a happy ending.

And yet, as I wrote in an earlier, watching the films, with all their flaws -- and also reading the books, albeit less vividly -- leaves me with a feeling of peace. Emotionally wrung-out, but brought to a good place by all the adventures I've gone along on.

Truly, we each see and read a different story. They are all colored by what we as individuals bring to them.

Cataract Journey 7: Settling in

It’s been several months (August) since my cataract surgery, and I’m adjusting to my new vision. My eyes have recovered from the surgery and my vision seem to have stabilized. It hasn’t changed noticeably over the last month or so.
So far, my experience continues to be positive. It’s amazing to open my eyes in the morning and be able to see clearly. I haven’t experienced the halos or other visual distortions that some patients with accommodative lenses report. My eyes had gradually become drier and scratchier over the years, and that is slightly improved, although I’m not sure why, maybe all the eye drops I used after the surgery. I’ve talked to other folks who’ve had cataract surgery and reported increased scratchiness afterward (to be fair, once I shared with them my optometrist’s protocol for dry eyes, they said it helped tremendously).
Here’s where I landed, vision-wise. I’ve gone from being incredibly near-sighted to being only slightly near-sighted. I had expected to be able to see clearly at intermediate (computer screen) and distance (driving) ranges, and to need reading glasses for close activities, but that turned out to not be the case. My vision for working at the computer and playing piano is excellent. I can’t remember seeing the piano music so crisply before. I can also read, unless the type is really small or I have to hold the book really close, so I use low-power over-the-counter reading glasses for reading in bed. My distance vision is not so great, especially in my weak eye. I can see well enough to drive places I already know how to get to, but reading street signs requires me to be fairly close to them (the letters and symbols of traffic signs are big enough, so that’s not a problem). I’d likely not pass the driver’s license vision test with my weak eye.
Now it’s time to decide what, if anything, I want to do about the residual near-sightedness.
This is what I’ve opted to do, and it’s working out so well, I doubt I’ll change my mind. The prescription that corrects me to 20/20 is not very strong compared to what I used to need. I got the lenses that turn dark in sunlight so I don’t need an additional pair of sunglasses. \I put on my driving glasses and zing! The distant world is amazingly sharp and clear. The dashboard of the car, not so much. Fortunately, the readout of my car’s odometer is quite large. When I take the glasses off, there are a few minutes of re-adjustment to blurred distance vision, but if I focus on something near or intermediate, I quickly re-adapt.
The biggest impact of being able to see this clearly is how much less stressful it is to drive at night. There is much less glare than with my old (hard) contact lenses and much better focus than with my old glasses. As we age, we tend to stay closer to home, anyway, and poor night vision contributes to that “drawing-in” and subsequent isolation. I no longer have that excuse, and I find myself being much more willing to drive places after dark.
One thing I hadn’t anticipated was that the material that makes the lenses dark is sensitive to ultraviolet, not visible, light. Car windshields filter out most of the uv (and I don’t have a convertible). So even though the road is very bright, the lenses stay clear. I have hit upon the solution of holding the glasses outside when I stop for a traffic light, so they get a good dose of uv. They get dark and stay dark until I drive through a shady patch and then I have to wait until the next light. In our rural area, these can be few and far between; for example, my town has no traffic lights, and only one stop sign along the main street. I’m thinking I might wear my glasses on a walk into town on a sunny day a few times.
One of the first things I noticed after the surgery was how brilliant colors were, especially the blue of the sky. I still marvel at the vividness of the world, and I hope I never lost that sense of wonder.

Guest Blog: More on Transgender Genetics

Welcome back! This week let’s look at a different paper that examined potential genetic causes for transgender.From Open Minded Health:In the last post, we looked at a SNP (“single nucleotide polymorphism” — a very, very tiny mutation at just one “letter” of novel of DNA) as a potential cause. This week’s paper looked at a different type of change: trinucleotide repeats.There are some sections of human DNA that have funny little repeats of three “letters”. If you remember, DNA has four letters: A, T, G, and C. Some parts of our DNA have long strings that looks like this: CAGCAGCAGCAGACAG. It’s called a trinucleotide repeat. Everybody has sections like this, and it’s not clear why they exist. The sections vary a lot from person to person, and change from generation to generation. Within the same person the repeat doesn’t change. Sometimes these repeats, when a person has a lot of them, can cause disease. Trinucleotide repeat expansions are the cause of both Huntington’s disease and Fragile X syndrome. Most of the time, though, trinucleotide repeats aren’t a problem.Repeats of other lengths are also found in humans — it can be as small as two letters (e.g., “AGCACACACACACACACACACATG”)So — what about this study?This study looked at nucleotide repeat sequences in three specific areas in trans women and cis men: CYP17, AR, and ERBeta. Yes, CYP17 is back! You may recall that’s involved in the creation of sex hormones. AR stands for androgen receptor — it codes for the receptors that testosterone binds to to cause its effects. And ER Beta is one of the estrogen receptor subtypes. Like AR, it is a receptor that estrogen binds to to cause its effect. In essence, this paper asked: “Do the number of nucleotide repeats in genes associated with sex hormones differ between transgender women and cisgender men?”The results?Some of them. There were no differences in ERBeta (the estrogen receptor) or CYP17. But the AR (androgen receptor) gene in trans women had longer nucleotide repeats than the cis men did. Since AR codes the androgen receptor, it is an even more important controller of masculinization of a fetus than testosterone itself is. As the researchers state, the difference in nucleotide repeats “might result in incomplete masculinization of the brain in male-to-female transsexuals, resulting in a more feminized brain and a female gender identity.”It’s an interesting thought and definitely in line with the brain research that’s been published. As always, we need more studies and more data to say that the cause is definitely the androgen receptor gene.Want to read the study for yourself? The abstract is publicly available!

Peter Jackson’s Middle Earth – Unexpected Gifts

It has often seemed to me that fans of J. R. R. Tolkien’s The Lord of the Rings (and The Hobbit) fall into two categories: those who adore Peter Jackson’s films and those who despise them. I fall into the former category and my husband into the latter. From our conversations, I have concluded that in most cases, it is impossible to change the other person’s mind (not to mention disrespectful to try). This is hardly a problem of cosmic importance, unless one person attempts to drag the other to all six extended cut versions of the movies or prevents the other person from enjoying them. Both sides put forth arguments and reasons, and they are entitled to them. I think just about everything that can be said has already been expounded upon.
I am firmly in the love-them camp. All the objections folks have are absolutely right, and have no relevance to my experience of the movies. The uncritical, immersive, “take me away” quality of my enjoyment of the films has definitely piqued my curiosity. What happens when I spend hours in Jackson’s Middle Earth?
In general, I am far less critical of visual media than of text. Because my own art form is prose, I have developed a keen internal editor and critic that may be regaled to the back seat but never entirely departs. I have no such filters for films or paintings. Only a horrifically bad film can destroy my suspension of disbelief, but horrifically bad films are enjoyable for quite different reasons than good ones.
I devoured Tolkien’s novels as a young adult, although I never wanted to run away to Middle Earth then. I found some aspects of the books frustrating: the “travelogue” passages were often tedious, I had no idea what Tom Bombadil was doing in the story, and I had trouble forming clear images of many of the places, for example Helm’s Deep. Nonetheless, I joined the ranks of fans wearing buttons that said “Frodo Lives!” and “Beware the Balrog.” I stood in line to see the films by Ralph Bakshi and Rankin-Bass (The Hobbit and The Return of the King), all of which I found unsatisfying. The hobbits and dwarves in the animated versions were silly, in bad need of haircuts, and the Bakshi film was just plain weird. The orcs looked like sabertoothed Sand People (from Star Wars), the Balrog was a costume from a bad opera, Boromir looked ridiculous in a Viking helmet, and none of the character moved in a natural way. Et cetera.
I had no idea who Peter Jackson was, but special effects had come a long way since the 1970s. Needless to say, I had excitement but not high hopes. I came prepared to see a live action version of the previous attempts. Five minutes into The Fellowship of the Ring, I was in love. The Jackson films “clicked” for me and brought the stories alive in ways that previous versions, even the original text, fell short.
This is not to say that everyone must feel the same way. Different media and different interpretations work for different people. I’m delighted that some folks prefer Tolkien’s text or even the animated versions. I am also delighted that this one form of presentation worked so well for me. When I go back and re-read the books, I can now immerse myself in the rich and varied landscapes of Middle Earth, and see and hear the characters.
After the extended editions of all three Ring movies came out on DVD (and I had watched all the commentaries and appendices), I set them aside. Every few years, however, I would watch them (3 movies over 2 days, usually, and when my husband – who is in the “doesn’t work for me” camp – was out of town). Either by happenstance or internal prompting, my schedule synchronized with the parole hearings of the man who raped and murdered my mother. That is, I’d gear up for the hearing, get re-traumatized no matter what precautions I took, come home and fall apart, and slowly put myself back together again. Some quality of the Jackson films spoke to me and offered itself as a healing tool.
I have some ideas of how this works. “Sanctuary” is one of them: a safe and glorious space, with companions who ensure I do not walk alone through the darkness. The defeat of evil when all hope is lost, with the crucial role of an act of mercy, a reminder to nurture my own capacity for compassion – for myself, for others. Lastly, the cathartic nature of the battle scenes.
This latter had not occurred to me until I was relating to an acquaintance that one of the ways I “let down” after a parole hearing was to watch the Jackson films. His response was that the films were way too violent for him (and he implied that exposure to violent scenes is in itself a destructive thing). As I thought about this, I realized that the re-triggering of past trauma, overlaid with new, painful revelations and the harrowing experience of entering a prison and seeing the perpetrator, left me saturated with feelings I had no way to discharge. Vigorous exercise was insufficient, and calming practices like yoga or meditation were too sedate. In years past, I practiced Chinese martial arts, particularly kung fu, but injuries and the absence of a studio ended that outlet 15 years ago.
On the other hand, if I allowed myself to enter into the world of the films, leaving my movie critic outside and immersing myself in the story, welcoming the psychological manipulation, I experienced a physical and emotional release. The length of the films gave me time to do this.

The effect was to shorten the time of tension and restlessness. It was as if I had taken my own nightmares and thrown them into the fight scenes, and then done battle with them, with Aragorn and Gandalf and Eowyn and all the others at my side. And in the end, I came home with Sam to my own garden.
Now I can watch them – and The Hobbit  movies as well – for escapist style entertainment, but there is always at least a hint of magic that lingers. The music has brought its own gifts, which I’ll share with you in a subsequent post.

Guest blog: Chaz Brenchley Steampunks Mars (With Added Hockey Sticks)

Chaz Brenchley is an amazing writer -- I've been an unabashed fan ever since I read Bridge of Dreams, which led me to write to him, begging for a story for my editorial debut, Lace and Blade. (That story, "In the Night Street Baths," was reprinted in Wild Stories 2009.) Now, many literary adventures later, Chaz sets his sights on Mars, complete with steampunk and a girl's boarding school placed in a failed hotel that was once a Norman castle. Read on for the delicious details...
One of the joys of living in the heart of Silicon Valley is that NASA Ames is just over there, and SETI HQ is even  closer. We live among the cool kids - and the cool kids like to share. I went to NASA for the recent transit of Venus; and ever since I moved here, I’ve been going to SETI’s weekly colloquium where planetary scientists and cosmologists talk about the latest discoveries, or the specific projects they have on a new mission, or the latest weird theory that’s almost a guaranteed Nobel prize if it should ever prove true (“but right now there are only two people who believe it, and they’re both in this room”), and like that.So there I was with planetary scientists at my fingers’ ends for the asking, and lots of Mars talk going on around the time of Curiosity’s landing, so it’s really no wonder that I started thinking about Mars fiction. Real Mars, not so much, for it is dry and inhospitable and I have written my desert books already - but old Mars, Mars with canals and an atmosphere and aliens? Oh, yes. Very much yes.And very much within that spirit, I wanted to steampunk it up a bit; and there was a lot of talk at that time in my social media about how steampunk tended to assume British Empire overtones, as though that were the only choice, and how it so very much was not. So I thought somewhat about that - but I did keep coming back to the British Empire, because I am far from home and the more time I spend in California the more inveterately Brit I become, and because I am the son of an Empire brat (Grandad was a major in the Scots Guards; Mum was born in Rangoon and grew up in Kuala Lumpur and Singapore, speaking Malay more readily than English), and because above all I was really curious. If Mars were a province of the British Empire, how would that actually work? How could it happen, and what would it mean - to the Empire, and to European and world history? And to Mars, and to the presumptive Martians? How do you impose colonial rule on a race that has no concept of empire, or statehood, or governance? And does it make a difference if you’re there by their courtesy, via their aetherships, for reasons you still don’t understand? And how do you negotiate even the broadest heads of agreement where you can barely communicate at all? [image error]And, and, and. This is one way that fiction happens, with a whole slew of questions that need answering. So this last couple of years, I have been writing stories that seek to do that. The first of them, “The Burial of Sir John Mawe at Cassini”, was published in Subterranean and picked up by Gardner Dozois for his Year’s Best SF anthology; the second - “The Astrakhan, the Homburg and the Red Red Coal” - appeared this year in Lightspeed’s “Queers Destroy SF” special issue (Oscar Wilde on Mars!). And I’m working on T E Lawrence on Mars, and A E Housman on Mars, and I’m irretrievably bogged down in a novel about Kipling on Mars (for many of these stories begin with “Y’know, if Mars were a province of the British Empire, [X] would so have gone there...”).So there’s that, and I am passionate about it, beguiled by it, almost obsessed with it. But I have other passions too, lifelong passions - and one of those is the Chalet School series by Elinor M Brent-Dyer. Sixty books, written over forty-five years: the tale of an English boarding school established in the Austrian Tyrol, with all that that implies. Mischief at midnight, practical jokes and punishments, prefects and dormitories and matrons and mistresses; but also adventures on a much greater scale, for these books were written in real time through the war and the girls witness anti-Semitic cruelty and take a stand against it and have to flee the Nazis themselves. And retreat first to Guernsey, which turns out not to have been such a good idea, and then to Wales; and spies come after them, and the makeshift migratory wartime school yields some of the best stories in the series. And then after the war the school moves to Switzerland (for it needs to stay close to the TB sanatorium that brings in many of its pupils, and staff too - and that supplies another constant theme to the series, loss and survival and the comforts of faith), and things go on much as before until the author’s death in 1970.These books have a cult following, including some surprising names that I shall not bandy here. And just a few weeks ago, I was walking home from the farmers’ market when I suddenly thought, “Y’know, if Mars were a province of the British Empire, the Chalet School would so have a sister foundation there...”It’s already established in the canon that boys are sent home to the great boarding-schools of England; but aethership journeys are expensive, and space is at a premium. Of course they’d want to educate their girls locally, oh yes...And so the Crater School was born, in a failed hotel built as a Norman castle, on the rim of a crater lake inhabited by a Martian naiad. Just across the water from a sanatorium, for Mars comes of course with its own diseases; and there are Basque shepherds on the slopes and Dutch families on the canal below, Indians and Chinese in the great port cities, and and and...And I’ve stitched all this together into a Patreon project, and we are going to have so much fun, it ought to be illegal. Or at least see us sent to the Headmistress on report. You can read the first two chapters for free here, and the Patreon page is here, if you’d like to support the Crater School for this term and beyond...And by the way, the stories sent out to subscribers as part of the Patreon project will eventually be published all in one place in a Book View Cafe edition.