Christian Theological/Philosophical Book Club discussion

38 views
The Forum - Debate Religion > The False Burden of Absolute Proof

Comments Showing 1-50 of 96 (96 new)    post a comment »
« previous 1

message 1: by Ned (last edited May 04, 2015 08:39AM) (new)

Ned | 206 comments This post will be about the nature of proof and evidence and will serve as a refutation of resident Sophist Stuart’s positions regarding the same. Stuart’s position(s) can be taken as typical of those supposedly practicing scientism or positivism. I say “supposedly” because it is also typical of such people to jump in and out of differing philosophies at will as the mood or emotional need strikes, thus their true positions are nebulous, often even to themselves. The reluctance to hold firmly to a particular philosophy stems from a desire to adopt particular positions in particular instances, but a stubborn refusal to follow the implications of those positions to their real-world and/or philosophical ends, and a hypocritical violation of their own stated precepts at very turn. They deal with these internal inconsistencies and contradictions by pretending they do not exist and glossing over serious issues. I do not fancy myself an expert an the subject, but this is a small forum, questions need to be raised and observations made, and someone needs to do it. I do take the time to research and ponder these issues, so I hope this will serve as a brief introduction.

Stuart’s stated position goes somewhat as follows:

I challenge you to produce “objective criteria to determine” truth claims.

I demand to see “evidence I can independently verify” to support truth claims.”

“Some of us reject the fantastical notion of Brahma/Yahweh/Allah, because we recognise the notion as primitive superstition, with not a shred of evidence behind any of these products of the human imagination.”

There is “not a shred of good hard evidence to begin believing in angels and virgins and resurrections based on nothing more than Bronze and Iron Age writings.”

“You don't have a shred of independently verifiable evidence to back up your beliefs in the superstitions you follow.”

“I'm asking people who do say there is "God" to give independent verification of their version of "God" No one ever does.”


And on, and on, ad nauseum. One immediately observes that Stuart makes himself the sole arbiter of what counts as “evidence” and what does not. Ironically, in Stuarts usage, the term evidence is automatically robbed of all objectivity from the start. Thus, some of the most ancient, well attested, reliable, verifiable, documents in history are disallowed as evidence. Is this approach objective? Hardly. It stems from a pre-existing bias, not a desire to honestly investigate. Bringing me to the first point.

With very few exceptions, there is no such thing as “objective evidence.”

That is to say, bare facts absent any interpretive framework. Simple math comes closest to qualifying. Most rational people have little problem with 1+1=2. After that things get sketchy. People immediately assimilate observations into their own interpretive framework. This is the only way that anyone can make sense of “evidence” in the first place. But the very act of doing so is inherently biased. A city dweller might see an animal he quite certainly classifies as a “black dog.” His notion depends on his perception of color and dogness. Perhaps the country dweller corrects him by saying, “No, that’s a dark-grey wolf.” Argument ensues. This may seem a ridiculously simple example, but it carries profound implications as can easily be seen within current culture. Some have constructed a race-based interpretive framework where all human behavior is evaluated in terms of racial bias. Thus, all white people are racists by mere virtue of their whiteness, and no black people can ever be racist by virtue of their blackness. Likewise with the issue of global warming. Overzealous global warming adherents will interpret any and all weather related data as proof of mankind’s destruction of the planet. If it doesn't fit, no matter, they can fake it. Objective?

At this point you may be saying to yourself, yes, but are not you also biased? Of course I am. We are all responsible for doing the best we can with what we have. Don’t misunderstand. I am not asserting that there is no such thing as objective TRUTH, or that reality cannot be determined. Discovering the truth is a matter of probabilities, not absolute certainty, and is generally an iterative process wherein prior assumptions and biases must continually be put to the test. Bringing me to the second point.

Absolute proof is an invalid guiding principle.

Absolute certainty is great when you can get it. I would love to be absolutely certain every time I make an investment that it will multiply a hundredfold. Or that every time I travel in a car that I will successfully reach my destination. And I am sure that every criminal investigator would love to present absolute proof to every jury. But none of us live like that nor can we. It is an obviously impossible ideal, making it a particularly attractive demand for the God-denier. “Hard, verifiable evidence” sounds so profound and high minded, and comes with the added benefit of being unachievable, relative to transcendent things. But the same standard which demands absolute proof of God’s existence is strangely absent in other areas of the demander’s life. Suppose you demand absolute proof that your parents are truly your parents. They show a birth certificate. Your grandparents, aunts, and uncles, all attest. No! You cry. I must have absolute proof! That birth certificate is an ancient document! Birth certificates can be faked! I need testimony from non-biased sources! You could get a DNA test, but even that requires faith in the examiner, that the sample wasn't tainted, etc.

Does one doubt that Socrates existed, and deny the quality of his character? Socrates never even wrote anything (sounds familiar.) We must rely on Plato. Some people actually do argue that Socrates is a fable. And the moon landing was faked. We consider those people nut cases.

How about non-material things like beauty? How does one go about proving the existence of beauty? Or does one just “know” it exists?

I will note that the same incredulity applied to Christian “myths” such as the virgin birth, the creation story, etc., suddenly turn to unblinking credulity when discussing modern mythology: vestigial organs, monkeys to man, magical primordial soup, transitional forms, multiverses, dark matter, etc. Anything at all as long as it doesn’t involve God, “hard verifiable evidence” or no. How ironic that Stuart mocks the creation of Adam the “mud-man” while uncritically accepting a self-creating, self-sustaining, life-giving “mud-universe” complete with self-evolving species which just happened to magically split into both male and female. And with consciousness, no less. Really. Who is more gullible? See how easy ridicule is?

Professor Richard Lewontin, a geneticist (and self-proclaimed Marxist), and one of the world’s leaders in evolutionary biology:

‘Our willingness to accept scientific claims that are against common sense is the key to an understanding of the real struggle between science and the supernatural. We take the side of science in spite of the patent absurdity of some of its constructs, in spite of its failure to fulfill many of its extravagant promises of health and life, in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism.

It is not that the methods and institutions of science somehow compel us to accept a material explanation of the phenomenal world, but, on the contrary, that we are forced by our a priori adherence to material causes to create an apparatus of investigation and a set of concepts that produce material explanations, no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is absolute, for we cannot allow a Divine Foot in the door.

The eminent Kant scholar Lewis Beck used to say that anyone who could believe in God could believe in anything. To appeal to an omnipotent deity is to allow that at any moment the regularities of nature may be ruptured, that Miracles may happen.


This is at least a position I can respect. Lewontin here admits that scientists make facts fit theories based on preexisting materialitic bias. Where does Lewontin think those "regularities of nature," otherwise known as laws, come from? It doesn't matter. It does not pay to be too curious.

Science still has to assume that the world has an intelligible order. Yet the materialist or naturalist worldview cannot account for that order. If the universe is the product of non-rational processes, why does it have a rational order? If the universe is not the product of a mind, why it is comprehensible to the human mind? Among most scientists today, "the underlying order in nature—the laws of physics—are simply accepted as given, as brute facts," Davies writes. "Nobody asks where they come from; at least they do not do so in polite company. However, even the most atheistic scientist accepts as an act of faith that... there is rational basis to physical existence manifested as law-like order in nature."

Science requires an "act of faith"? What is that "faith" based on? Davies draws this stunning conclusion: "So science can proceed only if the scientist adopts an essentially theological world view." — In short, every atheist has to adopt a biblical worldview to pursue science at all.

Nancy Pearsey - Finding Truth


The next point is a corollary of the previous one.

Evidence can only take one so far.

Not every question can be definitively answered by evidence alone.

An excerpt from “The Luck Factor” by Max Gunther

We often come up against situations in which any choice could be wrong, but paralysis would be wronger. Frank Stockton's notorious, unfinished story about the lady and the tiger is an annoyingly memorable example. The hero of the story incurs the wrath of a king, who sentences him to make a difficult choice. He is locked in an arena from which the only exits are closed doors. Behind one is a lady; behind the other, a tiger who hasn't been eating regularly. The hero's attempts to make his choice rationally, with facts, only lead him into deeper confusion and indecision. He isn't helped when the princess, his lover, points to one of the doors, for he doesn't know whether she is motivated by sympathy or jealousy. Yet he must make a choice, for to stay in the arena without opening a door means a slow but certain death by starvation. Stockton does not tell us what his hero did. One can hope for the hero's sake, however, that he harbored a superstition. Any superstition would have served. He was in a situation where no amount of fussing could help him to a wise choice – a situation in which his best move was to make a decision boldly and fast and be done with it.


The illustration of Buridan’s Ass is a similar example. The illustration is named after the 14th century French philosopher Jean Buridan who stated that, when presented with equally valid options, one must wait for new information before making a choice. The satirical cartoon depicts a donkey frozen between two equally-sized bales of hay, unable to make a decision until it starves to death.

I do not want to push the illustration too far, for I do not think the “God or no God” question is one of equally valid options, or insufficient evidence. I think that one may use the absence of absolute proof as an excuse to avoid making a decision, as in the case of agnosticism. However, as Buridan’s paradox illustrates, one is already in a position of choice leading to one’s ultimate demise.


message 2: by Ned (last edited May 03, 2015 03:28PM) (new)

Ned | 206 comments A couple of shreds

As for the “shreds” that Stuart keeps demanding but never can seem to get, I will briefly present a couple. There are many more, of course. He claims that I have the “burden to prove” my claim that God exists, he is the God of the bible, etc. I have admittedly been reluctant to even try because I do not think this is a genuine demand stemming from any real desire for knowledge. Moreover, I think Stuart will continue to deny that anyone has ever accepted his challenge for evidence no matter what I say. He will simply define the evidence into non-existence. Even Jesus was silent in the face of some. However, I only accept this “burden” in part. I do believe it is the duty of every Christian to defend his or her faith. But the existence of God is not merely “my” claim. God is a facet of the world as it is. It is the duty of every human being to vet reality and truth for themselves, and would of course be a far more productive pursuit for Stuart, than constantly asking someone else to spoon feed him.

1.) The worldwide flood.

I am aware that the great Noahic flood is a favorite laughing stock of Stuart’s. This is a case of willful denial of valid evidence. The question is whether our present reality is consistent or inconsistent with the Noahic flood. Obviously it is consistent. There is no rational reason to deny it. There is every idealogical reason, however. Geology is consistent with a worldwide flood. Evidence of marine life is found at high elevations, such as the Himalayas. Scientists with an ideological bias must explain this away by positing natural upheaval from sea floors over millions of years rather than a catastrophic flood. If that’s the way you want to go, that’s fine. But don’t tell me that your antibiblical bias equals lack of evidence. This is in brief. I have not listed all the geological evidence.

Large, intact animal fossils are consistent with catastrophic preservation. Intact preservation must be caused by sudden, catastrophic events. This is consistent with the flood. It is not consistent with gradual, imperceptible change.

Many flood myths.

There are two ways of looking at flood myths among ancient civilizations. One is that they all merely copied one another until similar stories were circulated around the globe. But another is that the stories are consistent with corroborating witness testimony, which normally SUPPORTS whether a given event happened. The only reason to prefer the first theory is anti biblical bias. This is a clear case of “damned if you do, damned if you don’t.” The evidence will be interpreted by naysayers in a negative light.

There you go. Verifiable physical evidence.

2 Peter 3 (NIV)

3Above all, you must understand that in the last days scoffers will come, scoffing and following their own evil desires. 4They will say, “Where is this ‘coming’ he promised? Ever since our ancestors died, everything goes on as it has since the beginning of creation.” 5But they deliberately forget that long ago by God’s word the heavens came into being and the earth was formed out of water and by water. 6By these waters also the world of that time was deluged and destroyed. 7By the same word the present heavens and earth are reserved for fire, being kept for the day of judgment and destruction of the ungodly.

8But do not forget this one thing, dear friends: With the Lord a day is like a thousand years, and a thousand years are like a day. 9The Lord is not slow in keeping his promise, as some understand slowness. Instead he is patient with you, not wanting anyone to perish, but everyone to come to repentance.

10But the day of the Lord will come like a thief. The heavens will disappear with a roar; the elements will be destroyed by fire, and the earth and everything done in it will be laid bare.


2) Restoration of Israel

Israel should never have survived as a nation. The diaspora should have been the end of them. Hebrew should never have been revived from ancient to modern usage. Such a thing has never happened. Many biblical prophecies proclaimed Israel’s restoration and prosperity thousands of years in advance. It is said that in the last days, the “times of the gentiles” will come to an end and Israel will become dominant. There is no natural reason that Israel should be as prosperous as it is, either. Her economic success is remarkable, as is her astounding victories over her aggressive neighbors, over multiple fronts, in war.

In Isaiah 43:5-6, the prophet Isaiah said that the Jews would return to their homeland from the east, the west, the north and the south. Isaiah lived about 2700 years ago. At that time, the Assyrians had forced many Jews in the northern kingdom of Israel into exile. Those Jews were taken to other areas in the Middle East. Then, about 1900 years ago, the Romans destroyed the city of Jerusalem and killed and exiled hundreds of thousands of Jews. Since then, the Jews have been scattered to virtually every country in the world. But, during the past century, millions of Jews have returned to Israel, from the east, the west, the north and the south.


No doubt Stuart will dismiss this as “coincidence” and “not a shred of evidence.” The fact remains that this is remarkable prophecy fulfilled in our own lifetime. Nothing short of amazing. Verifiable physical evidence.


message 3: by Ned (last edited May 04, 2015 06:44AM) (new)

Ned | 206 comments The Bible is firmly grounded in history.

Stuart has been fond of saying that the bible and the biblical God are "imaginations" and "myths." This is an obvious false assertion. Mythology reads as such. The characters in mythology are typically beings with exaggerated human characteristics, which is to say selfish, capricious, and flawed. They are polytheistic. Idols representing or associated with parts of creation. They are not grounded in actual historical times and places like the bible reliably, verifiably, is. There is no pagan counterpart to the great "I AM."

All the major biblical cities and geographical features have been located, including Jerusalem, Jericho, the Sea of Galilee, the Galilee region, the Dead Sea, the Jordan River, Caesarea, Dan, Caesarea sarea Philippi, Beth Shan, Gezer, Hazor, Beersheba, Megiddo, Memphis, Alexandria, Luxor, Thebes, Babylon, Nineveh, Athens, Thessalonica, Corinth, Rome, Ephesus, Philippi, Smyrna, and dozens more.'

Currently, there are approximately 60 biblical figures in the Old Testament that have been identified through historical and archaeological research. These include Nebuchadnezzar II, Belshazzar, Sennacherib, Darius, Xerxes, Artaxerxes I, Cyrus, Jeroboam, Baruch the scribe of the prophet Jeremiah, Shema the servant of Jeroboam II, David, Solomon, Balaam, and many other kings of Israel and Judea, among others.

The Poular Handbook of Archeology and the Bible.

By contrast, when and where did the Iliad and Odyssey happen? The difference in fact and mythology is not that hard to discern, unless of course, one has a loaded agenda.

More verifiable physical evidence supporting biblical veracity.

For we did not follow cleverly devised stories when we told you about the coming of our Lord Jesus Christ in power, but we were eyewitnesses of his majesty. 2 Peter 1:16


message 4: by Ned (last edited May 04, 2015 09:18AM) (new)

Ned | 206 comments Dubious historical method

Mark W. Foreman provides a humorous anecdote concerning the "parallells" method used by some historians intent on undermining the authority of scripture, as famously presented in the Zeitgeist movie.

The first portion of the film is divided into two main arguments: (1) Christianity is a myth based on teachings from earlier pagan myths; (2) all these myths, including Christianity, are in essence astrologically based—a view called "astrotheology." ...

While the ideas portrayed in Zeitgeist may be new to many viewers, the basic charge is an old one. The copycat theory emerged in the mid-nineteenth century and was popularized mostly through James Frazer's The Golden Bough (1890). It continued until the early twentieth century, when its methods and conclusions were rejected by critical scholars. In fact, the vast majority of sources cited in the online Zeitgeist transcript to support its claims come either from these late-nineteenth- and early-twentieth-century authors or from more recent writings that depend heavily on these sources.- While the copycat theory is largely ignored by critical scholars, the movement has gained some new momentum more recently, in part owing to films such as this. While the view is regaining popularity, however, no new evidence has been presented in its support. The same old sources are just being dusted off and repackaged as slickly produced films like Zeitgeist. Arguments don't stop being bad simply because of their upgraded, flashy attire....

Imagine we are 2,000 years in the future. Through some sort of cataclysmic event only a handful of documents of the history of the United States are available, and these are just fragments. After sifting through these fragments, a small group of historical enthusiasts come to a radical conclusion: The myth of President John F. Kennedy is based on the earlier myth of Abraham Lincoln. Their reason for such a conclusion: "Just look at all the parallels!"

• Lincoln was elected to Congress in 1846; Kennedy was elected to Congress in 1946.
• Lincoln was elected president in i860; Kennedy was elected President in i960.
• "Lincoln" and "Kennedy" each have seven letters in their names.
• Lincoln had a secretary named Kennedy; Kennedy had a secretary named Lincoln.
• Both married, in their thirties, a 24-year-old socially prominent girl who could speak fluent French.
• Both presidents dealt with civil rights movements for African-Americans.
• Both presidents were assassinated on a Friday, in the back of the head, before a major holiday, while sitting next to their wives.
• Both their assassins were known by three names consisting of 15 letters (John Wilkes Booth, Lee Harvey Oswald).
• Oswald shot Kennedy from a warehouse and was captured in a theater; Booth shot Lincoln in a theater and was captured in a warehouse
• Both assassins were shot and killed with a Colt revolver days after they assassinated the president and before they could be brought to trial.
• Both presidents were succeeded by vice presidents named Johnson, from the South, born in 1808 and 1908 respectively.

This example shows that insignificant, spurious, false, and misleading parallels can be used to argue just about anything.

Come Let Us Reason: New Essays in Christian Apologetics



message 5: by Ned (last edited May 04, 2015 07:58PM) (new)

Ned | 206 comments Exodus plagues confirmed by extrabiblical scources.

There are many historical finds supporting the historicity of the Egyptian plagues, but chief and most impressive, and the only one I will cite here, is the IPUWER PAPYRUS - LEIDEN 344

More evidence.


message 6: by Joshua (new)

Joshua Woodward | 556 comments great posts Ned.


message 7: by Ned (new)

Ned | 206 comments Thanks, Joshua.


message 8: by Ned (new)

Ned | 206 comments The Table of Nations (Genesis 10)

Dr. William F. Albright, universally acknowledged as the world’s leading authority on the archaeology of the Near East, though himself not a believer in the infallibility of Scripture, said concerning this Table of Nations: It stands absolutely alone in ancient literature, without a remote parallel, even among the Greeks, where we find the closest approach to a distribution of peoples in genealogical framework.... The Table of Nations remains an astonishingly accurate document.

Morris, Henry M. (2010-07-27). Genesis Record, The: A Scientific and Devotional Commentary on the Book of Beginnings (p. 229). Baker Book Group



message 9: by [deleted user] (new)

In the beginning the Elohim created the heaven and the earth. Jewish and pre-Jewish mythology.

In the beginning Mbombo created the heaven and the earth. African mythology.

In the beginning Ptah created the heaven and the earth. Egyptian mythology.

In the beginning Vishvakarman created the heaven and the earth. Hindu mythology.

In the beginning Ranganui created the heaven and the earth. Polynesian mythology.

None of which offer a shred of anything beyond human-written "scripture".

There is a possibility that "God" created the heaven and the earth. But certainly not in either of the ways described in the contradictory 6 Day or 1 Day biblical creation myths - or any of the other mythologies.

And then there's the mud-man and rib-woman of Jewish mythology to compare with the first humans from other mythologies.

And the date for the first Homo sapiens of about 4,000 years before the descendant of the deposed David god-kings, Jesus, was sired by the mythological Jewish deity, Yahweh.


message 10: by [deleted user] (new)

And a date for the genocidal filling of the biblical dome of heaven with the water from outside the dome, by both the Elohim and Yahweh, was conveniently not mentioned.

Even though our good friends at Answers in Genesis have helpfully counted the begats and put it at precisely 2,348 years before Jesus' miraculous incarnation. A date that places it at about the beginning of the uninterrupted by Jewish mythology or anything else 6th Egyptian Dynasty.

It's the bits that people leave out that reveals o much about them.

There was no literal global flood.

http://www.bibleinterp.com/articles/f...

http://www.talkorigins.org/faqs/faq-n...

http://rationalwiki.org/wiki/Global_f...


message 11: by Joshua (new)

Joshua Woodward | 556 comments haven't we been through this before Stuart.


message 12: by Joshua (new)

Joshua Woodward | 556 comments I should say for the benefit of the readers we had a protracted discussion about the memory of the flood recounted in folklore all over the world.

What's more interesting is the account of cataclysmic flooding at the beginning of the Xia dynasty in China. A fascinating account because the timeframe is almost identical to the biblical record.


message 13: by Ned (new)

Ned | 206 comments The Hebrews: God's Particular People

Mythology experts have examined the contention that the creation story and flood account in the bible are based on earlier pagan legends. They conclude that such a scenario is highly unlikely, for one simple reason. The evolution of the stories is in the wrong direction. Evolving mythological accounts tend to grow more and more embellished and complex as time goes on, much like modern "fish stories." They NEVER evolve from complex to simple. The accounts in the bible are notable for their simplicity. "In the beginning, God created the heavens and the earth... God said let there be light and there was light..." Simple, direct, unembellished. There are other reasons, such as the human-centeredness of pagan accounts, designed to glorify a particular dynasty or ruler, and so forth. But I find the "myth direction" argument persuasive, and completely true to what I know if human nature. This means, of course, that pagan mythology is based on biblical accounts. Not the other way around.

What strikes one about the Jewish description of creation and early man, compared with pagan cosmogonies, is the lack of interest in the mechanics of how the world and its creatures came into existence, which led the Egyptian and Mesopotamian narrators into such weird contortions. The Jews simply assume the pre-existence of an omnipotent God, who acts but is never described or characterized, and so has the force and invisibility of nature itself: it is significant that the first chapter of Genesis, unlike any other cosmogony of antiquity, fits perfectly well, in essence, with modern scientific explanations of the origin of the universe, not least the ‘Big Bang’ theory....

Moreover, this personal God, from the start, makes absolutely clear moral distinctions, which his creatures must observe, so that in the Jewish version of early man moral categories are present and imperative from the very beginning. This again differentiates it sharply from all pagan accounts. The prehistoric sections of the Bible thus constitute a kind of moral fundament, upon which the whole of the factual structure rests. The Jews are presented, even in their most primitive antecedents, as creatures capable of perceiving absolute differences between right and wrong.

The notion of a moral universe superimposed on the physical one determines the treatment of the first truly historical episode in the Bible, the description of the Flood in Genesis 6. There can now be no doubt that some kind of huge inundation did occur in Mesopotamia. The first corroboration of the Biblical account took place in 1872 when George Smith of the British Museum discovered a version of the Deluge in cuneiform tablets found by A. H. Layard in 1845-51 at Kuyunjik in the library of the Palace of Sennacherib, confirmed by further tablets found in the Palace of Ashurbanipal.10 This was in fact a late-Assyrian version, interpolated at the end of a much earlier epic known as Gilgamesh, which deals with an ancient Sumerian ruler of Uruk, in the fourth millennium BC. Before the Assyrians, both the Babylonians and the distant Sumerians treasured memories of a great flood. In the 1920s, Sir Leonard Woolley found and excavated Ur, an important Sumerian city of the fourth and third millennia BC, which is mentioned in the Bible at the very end of its prehistoric section.11 While investigating the earlier archaeological levels at Ur, Woolley made prolonged efforts to unearth physical evidence of a dramatic flood. He found an alluvial deposit of 8 feet which he dated 4000 to 3500 BC. At Shuruppak he came across another impressive alluvial deposit, and an 18-inch one at a similar stratum at Kish. But these datings, and Ur’s, did not match.12 Surveying the various sites which had been explored by the early 1960s, Sir Max Mallowan concluded that there had, indeed, been a giant flood. 13 Then in 1965 the British Museum made a further discovery in its deposits: two tablets, referring to the Flood, written in the Babylonian city of Sippar in the reign of King Ammisaduqa, 1646-1626 BC.

The importance of this last discovery was that it enables us to focus on the figure of Noah himself. For it relates how the god, having created mankind, regretted it and decided to drown it by flood; but Enki, the water-god, revealed the catastrophic plan to a certain priest-king called Ziusudra, who built a boat and so survived.14 Ziusudra was undoubtedly a real person, king of the south Babylonian city of Shuruppak about 2900 BC, in which capacity he figures in the earliest column of the Sumerian king-list. At the site of Shuruppak itself there is evidence of a phenomenal flood, though the dating does not correspond with Woolley’s flood at Ur.15 The saviour-figure of Ziusudra, presented in the Bible as Noah, thus provides the first independent confirmation of the actual existence of a Biblical personage.

There is, however, a fundamental difference between the Biblical presentation of the Flood and the Babylonian-Sumerian epics. Noah, unlike Ziusudra, is a moral figure, anchored firmly in the scheme of values which theBook of Genesis identifies from the very beginning. Moreover, whereas the Gilgamesh story recounts isolated episodes lacking a unifying moral and historical context, the Jewish version sees each event as involving moral issues and, collectively, bearing witness to a providential design. It is the difference between secular and religious literature and between the writing of mere folklore and conscious, determinist history.

Johnson, Paul (2009-03-17). History of the Jews (pp. 8-9). HarperCollins.



message 14: by Ned (last edited May 06, 2015 05:03AM) (new)

Ned | 206 comments
I am Mkoi, the storyteller. I will start before the beginning…

When there is still naught but the dark, the Only God, Mbombo, feel sick and alone. When the sickness get the best of him, he retch white-hot fire from his gut, and spew out the sun.

Daylight is born, an Mbombo feel a little better.

Mbombo like the day, and he want to share some with the night, so when the sickness tell him to, he disgorge the crumbs of fire that still trouble and tumble in his belly…the moon and the stars explode and expel from his wide, heavin’ mouth.

Now Mbombo have the light, the dark, the sun, the moon, and the countless stars for company. He watch them twirl and twinkle, light and dark, light and dark, in a never-ending dance. But the dance make Mbombo dizzy, and he feel sick and alone again. He sit, wait, and wonder what he will vomit next.

When the sickness finally bring him to his knees, Mbombo delight to see he retch up nine kind of animal.

Mbombo feel so much better now, He turn his back on his vomit, and go on with more important God business.


Yep. Just like the bible. One can hardly tell the difference. The bible starts at the beginning? I will start BEFORE the beginning!

Stuart said: "In the beginning Mbombo created the heaven and the earth..."

The version I read indicates the the creator is a "white giant" who gets sick and pukes; not even an intentional act. But Stuart can't resist embellishing to make the account sound "just like the bible."


message 15: by [deleted user] (last edited May 06, 2015 02:00PM) (new)

The context of the idea of absolute proof

Ned, I find your original argument wobbles from strong to weak and back again because you're not considering types of evidence in a systematic way.

Evidence is broken down, to begin with, as apodictic or empirical. Beyond that dichotomy, there are matters of speculation or pure testimony.

1. Apodictic. Many mathematical items can be proven from unarguably simple first principles, and this steel fibre of reality passes on to a large extent to mathematical physics. You probably know that our nemesis Bertrand Russell had high hopes of rationalizing all mathematics this way, and was let down by Kurt Gödel's demonstration that (my favourite topic) autoreferentiality made this impossible - math was susceptible to 'this statement is false' type contradiction. Nonetheless, locally, items that are based on math are evidentially good. That's why, even when fallible materials and builders are involved, you dare to cross a bridge designed by competent engineers.

Principia Mathematica, 3 Vols
Kurt Gödel Collected Works Volume I: Publications 1929-1936



2. Empirical

a) falsifiable

The ground level of empirical evidence is still evaluated very well, despite later developments, by Karl Popper's 'falsifiability' criterion. If an assertion can't in principle be shown to be false, then it doesn't belong in the realm of the experimentally amenable empirical. If I say 'soap supplement X may cause feminization of male mice,' then there has to be some way in principle to show not just that the assertion is right, but also that the assertion is wrong, that X does not do this. Perhaps X always does feminize male mice, but if you add a hydroxyl group onto it to produce compound Y, it becomes harmless. Any paranoid conspiracy theorist who then says 'compound Y still has X in it so it must feminize male mice, no matter what the data say,' and who can't accept any evidence that this is not true, is not getting a grip on the nature of empirical evidence. Those who work with things that can be discretely shown to do an action or not do it are on solid ground in terms of empirical evidence.

A rule of thumb that we often go by in experimental science is that another experimenter repeating our methods must obtain the same results, plus or minus any minor variability that may exist in the system.

The Logic of Scientific Discovery

b) Things that can be consistently modeled but not falsified.

There are items like 'will there be a thunderstorm in Lexington at 6 pm tomorrow?' that can be modelled mathematically but not falsified per se - the data and the number crunching can only generate a certain probability that the thunderstorm will be there. No science is necessarily refuted if it is not. As long as the assertions are probabilistically correct (e.g., correct 80% of the time when they state they'll be correct 70-90% of the time), then individual departures from the expected don't falsify them. The underlying math in matters like chaos theory may even clarify what's going on with the level of unpredictability we see. Climate change science is heavily involved in this type of epistemology and is sore afflicted by naysayers mischievously denying its predictions because, for example, one winter was colder than expected.

A distinguishing feature of this type of changeable system is that it doesn't have a built-in, changeable carrier of information that modifies the basis of its activities over time. Air always flows according to the same basic equations; it doesn't have a way to alter its responses to matters like temperature and land-forms.

c) things that embed a changeable information-carrying basis-of-operations that alters their responses.

Once entities are complex enough to carry their own reprogrammable informational basis of operation within them, they attain a new level of unpredictability. All life forms have one such basis, the genes. Animals have a second one that changes on a smaller time-scale, the brain. One can model what such entities do on a limited time-scale, in disciplines like ecology, sociology and economics, but there is no way to make extended predictions prospectively (looking into the future). Also, retrospective predictions about the nature of undiscovered historical entities (missing evolutionary links, lost human cultures) can only be approximate.

In determining the truth value of long-term assertions about this type of system(such as, humans evolved from the great-ape lineage), independent verifiability through experiment isn't available. The best evidence one has is a good model that fits all the verifiable facts. Anyone hoping for a human race that wasn't a descendant of apes experienced a series of setbacks in the 19th and 20th centuries as the fossil record and comparative anatomy disclosed a lot of consistent concord with the ape --> human path of evolution. In the 1990's, though, when mass-scale gene sequencing got underway, the statistical support fitting this scenario became extremely high.

Statistical support, however, isn't absolute, and moreover, without falsifiability, people could still claim that as much as humans structurally appeared as apes, especially in thousands of common DNA signatures (synapomorphies, we call them), the appearance of similarity was either coincidence or deliberate mimicry. It was possible to hypothesize that 'God put those humans together independently but gave them all those ape-like parts either out of economy or as a satire or pit-trap directed towards the scientists of the future.'

This is where the principle that Stuart relies so heavily on, parsimony, Occam's razor, came into play: "entities must not be multiplied beyond necessity." Everyone must concede that it can't be disproven that there might be a God who would so arrange genes and bones as to make humankind an ingenious mock-ape epistemological trap for any created being who was so arrogant as to trust the evidence of his/her senses. But this seems to be a lot of fuss, rather implausible. Moreover, the God who is usually suspected of this isn't alleged to be a Trickster god, like Anansi, but rather a loving God, so we must also unparsimoniously add a trickster layer into the personality of YHVH in order to arrive at the independently created human species with all the ape-like elements. It seems much more sensible to concede evolution, and also acclaim God's upright character, and let the creation story be that most powerful of instructive devices, a story.

3. Speculative / Testimonial

The topics Stuart usually discusses with us are from the next level of matters evaluated by parsimony - matters that, unlike evolution, provide no discrete, manipulable evidence to base a hypothesis on. Moreover, they are matters of a nature that, if changeable carriers of operative information are involved, those carriers are present in forms that are inaccessible to our direct investigation. We can't sequence or scan or even draw any observed aspect of a putative god.

My problem with Stuart's assertions, as people know, is that he attempts to use parsimony to make a tabula rasa in the purely speculative area of whether there is a God or no God. He treats God as a causal factor 'multiplied beyond necessity.' He often magnifies the unparsimoniousness of God by bringing in a variety of stories, most of which have little currency, about semi-parallel 'other' gods. Actually, there's no strong parsimony case to be made for 'the universe as we know it just was' as opposed to 'something created/ started up the universe as we know it', so that matter rather hangs in the balance. The interesting problem with the 'something started it up' scenario is that a purposeful start-up is one of two substituent options. People who claim to have interactions with carriers of such a purpose aren't a-priori devoid of credibility, even though they are rightly treated with caution. It's only when the purpose-bearer is consistently attributed extraordinary wisdom and/or apparent miraculous intervention that the testifiers begin to look good. One thing about the negating trend in parsimony is that it is hard pressed to accumulate wisdom, since skepticism is so often the fall-back position that wisdom drops to when it is subjected to worldly hard knocks. Lovers of wisdom may thus choose to remain moderately unparsimonious about the purposeful creator whose alleged history they most associate with wisdom and benevolent miracle. You could say it's a matter more of taste than of science.

But one doesn't need to defend that by trying to contradict science. The marine life in fossil material embedded in the mountaintops is all meticulously arranged according to its historical period in evolution and gives no support at all to a one-event, recent flood. The level of unparsimoniousness needed to imagine God layering the mountains with tens of thousands of extinct species as an elaborate exercise in falsehood goes far beyond Christianity; and moreover, there is no trace of wisdom in the imagined result. It would just be tricksterdom on an unimaginably grand scale. For my taste, attributing that tricksterdom to YHVH would be wrong on many levels. The main thread of my slight strand of unparsimony is that God is love.


message 16: by [deleted user] (new)

This is what I'm looking for:

"All the major biblical cities and geographical features have been located, including Jerusalem, Jericho, the Sea of Galilee, the Galilee region, the Dead Sea, the Jordan River, Caesarea, Dan, Caesarea sarea Philippi, Beth Shan, Gezer, Hazor, Beersheba, Megiddo, Memphis, Alexandria, Luxor, Thebes, Babylon, Nineveh, Athens, Thessalonica, Corinth, Rome, Ephesus, Philippi, Smyrna, and dozens more.'

Currently, there are approximately 60 biblical figures in the Old Testament that have been identified through historical and archaeological research. These include Nebuchadnezzar II, Belshazzar, Sennacherib, Darius, Xerxes, Artaxerxes I, Cyrus, Jeroboam, Baruch the scribe of the prophet Jeremiah, Shema the servant of Jeroboam II, David, Solomon, Balaam, and many other kings of Israel and Judea, among others.

The Poular Handbook of Archeology and the Bible.

By contrast, when and where did the Iliad and Odyssey happen? The difference in fact and mythology is not that hard to discern, unless of course, one has a loaded agenda.

More verifiable physical evidence supporting biblical veracity."


There we have it! Hallelujah! Biblical items independently verified by means and methods outside the Jewish writings. You know, good, old-fashioned, down-to-earth, spirituality and talking animal free, un-arbited by me, evidence. Excellent.

Now let's do the same for the Elohim opening up a great dome of air in the water of the biblical universe, and sticking stars on the ceiling after creating the Earth's vegetation.

Let's do the same for the contradictory single day re-creation by Yahweh Elohim and the first Homo sapiens from mud and a rib, 4004 years before the mythological Jewish Yahweh sired the Davidic god-king, god-man Jesus.

And yes, lets do the same for Jesus plonking himself into the uterus of the Blessed Virgin Mary in a backwater on the frontier of the Roman Empire to become a human sacrifice to appease the genocidal Yahweh, so he won't send Jewish and non-Jewish sinners who had never heard of this pagan Jewish deity, to the eternal torture chamber.

You know, all the magical, miracle, make-believe stuff I go on about ad nauseam, and believers dodge and duck and weave around, and throw up smokescreens of "philosophy" or protracted distractions about "false burdens", or all the usual tricks to avoid admitting that don't have a shred of anything outside the biblical mythology, folklore, propaganda and praise for the magic stuff.

Because it is magic stuff.

It's not real.

Yahweh is as make-believe as any other version of "God".


message 17: by Ned (last edited May 06, 2015 03:04PM) (new)

Ned | 206 comments Mark,

Thanks for your thoughtful comments. I will just zero in on a couple, though I don't think these are bunnies I want to go chasing very far at the moment.

Anyone hoping for a human race that wasn't a descendant of apes experienced a series of setbacks in the 19th and 20th centuries as the fossil record and comparative anatomy disclosed a lot of consistent concord with the ape --> human path of evolution. In the 1990's, though, when mass-scale gene sequencing got underway, the statistical support fitting this scenario became extremely high....

The marine life in fossil material embedded in the mountaintops is all meticulously arranged according to its historical period in evolution and gives no support at all to a one-event, recent flood.


I do not think these are supportable statements, especially with respect to your former claim. In fact, I think the science is trending in the opposite direction as ape to man evolution seems increasingly more improbable the more we learn.

The fossil record is far from "meticulously arranged" except abstractly in textbooks.


message 18: by [deleted user] (last edited May 06, 2015 03:15PM) (new)

Creator not disprovable, ergo, creator may exist/supervene.

Deliberate creation is 'miraculous,' ergo, even within an established, created order of nature, further miraculous events may occur.

Creator, as an undertaker of action, is a lectont (a choosing entity), ergo may also choose specific attributes (name) or actions (including strategic self-revelations).

Nothing stops people with inspirations of the Creator's existence, or hopes for such an existence, from producing miscellaneous tales about other names besides the one reported to have been voiced to the Jews by the Creator self. Fan fiction, perhaps misguided, doesn't change the real story. The recent 'Abraham Lincoln as vampire' movie doesn't cast doubt on the purely human existence of Abe.

This series of logical steps is unparsimonious, but the elaboration of a universe de-novo is also unparsimonious.


message 19: by [deleted user] (new)

Ned wrote: "Mark,

Thanks for your thoughtful comments. I will just zero in on a couple, though I don't think these are bunnies I want to go chasing very far at the moment.

Anyone hoping for a human race that..."


This response is plain nonsense and an insult to Mark.

Check out the beautiful irony here:

https://www.youtube.com/watch?v=ezQhV...


message 20: by [deleted user] (new)

Mark wrote: " The context of the idea of absolute proof

Ned, I find your original argument wobbles from strong to weak and back again because you're not considering types of evidence in a systematic way.

E..."


Umm, no, I don't treat "God" as a "causal factor".

I treat human imaginings of the possibility of "God" as superstitious make-believe.


message 21: by [deleted user] (new)

Ned, I recommend you a most excellent toy, called BLAST, as in 'have a...'
http://blast.ncbi.nlm.nih.gov/Blast.cgi

You can take any gene from the human genome database and do a comparison with any other species' sequences, or all the other creatures at once, if you like.

First, go here: http://www.ncbi.nlm.nih.gov/nucleotide
Plug in the name of a human gene and search on it. I put in 'human cox' for cytochrome oxidase. That led me here: http://www.ncbi.nlm.nih.gov/gene/9377

Then I needed to get the sequence data, so I clicked on the 'Primary Source'. Came out here: http://www.genenames.org/cgi-bin/gene...

(sorry so many steps)

Then had to click on 'nucleotide sequences' 'Genbank' button to come out here where the actual sequence is: http://www.ncbi.nlm.nih.gov/nuccore/M...

Grabbed the sequence, which is:

ORIGIN
1 gggcgccgcc atcgccgtca tgctgggcgc cgctctccgc cgctgcgctg tggccgcaac
61 cacccgggcc gaccctcgag gcctcctgca ctccgcccgg acccccggcc ccgccgtggc
121 tatccagtca gttcgctgct attcccatgg gtcacaggag acagatgagg agtttgatgc
181 tcgctgggta acatacttca acaagccaga tatagatgcc tgggaattgc gtaaagggat
241 aaacacactt gttacctatg atatggttcc agagcccaaa atcattgatg ctgctttgcg
301 ggcatgcaga cggttaaatg attttgctag tctagttcga atcctagagg ttgttaagga
361 caaagcagga cctcataagg aaatctaccc ctatgtcatc caggaactta gaccaacttt
421 aaatgaactg ggaatctcca ctccggagga actgggcctt gacaaagtgt aaaccgcatg
481 gatgggcttc cccaaggatt tattgacatt gctacttgag tgtgaacagt tacctggaaa
541 tactgatgat aacatattac cttattttga acaagtttcc ctttattgag taccaagcca
601 tgtaatggta acttggactt taataaaagg gaaatgagtt tgaactg

Now, keeping the sequence in the copy buffer, back to the 'BLAST' link at the top of this post.

Click on the link there that says 'nucleotide blast'

Then, in the big blank space that says 'enter query sequence,' copy in that chunk of sequence data (including the word 'ORIGIN')

In the 'database' tab below, choose 'nucleotide collection' ... then ignore the other choices and just scroll down to the bottom and click on the big button that says 'BLAST'

The program makes you wait for a minute or two and then generates a tabulated list of most similar sequences. I can't copy in the table, but here's the list of top hits, minus some factors like the percentage of similarity.

1. Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase Va subunit mRNA,

2. Homo sapiens cytochrome c oxidase subunit Va (COX5A), NM_004255.3
Homo sapiens cDNA

3. Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase

4. Homo sapiens cytochrome c oxidase subunit Va,

5. Homo sapiens cDNA: FLJ22962 fis, clone KAT10227, highly similar to HUMCOXNE Homo sapiens nuclear-encoded mitochondrial cytochrome c oxidase

6. PREDICTED (meaning, found by automated comparison in data from a whole-genome sequence, but not yet checked out by a researcher as a confirmed COX) Pan troglodytes mitochondrial cytochrome c oxidase subunit Va (COX5A),

[Pan troglodytes is the chimpanzee]

7. PREDICTED: Nomascus leucogenys cytochrome c oxidase subunit 5A,

[this animal is the white-faced gibbon]

8. PREDICTED: Nomascus leucogenys cytochrome c oxidase subunit 5A,

9. PREDICTED: Pongo abelii cytochrome c oxidase subunit 5A, mitochondrial-like (LOC100459812),

[this is a bonobo chimpanzee, etc. - other names, see wikipedia]

10. PREDICTED: Pongo abelii cytochrome c oxidase subunit 5A, mitochondrial

11. PREDICTED: Cercocebus atys cytochrome c oxidase subunit 5A, mitochondrial

12. PREDICTED: Macaca nemestrina cytochrome c oxidase subunit 5A, mitochondrial

13. PREDICTED: Papio anubis cytochrome c oxidase subunit 5A (COX5A),

14. Macaca mulatta cytochrome c oxidase subunit 5A (COX5A),

15. Chlorocebus sabaeus cytochrome c oxidase subunit 5A, mitochondrial

16. PREDICTED: Cercocebus atys cytochrome c oxidase subunit 5A, mitochondrial pseudogene

PREDICTED: Pan paniscus cytochrome c oxidase subunit 5A, mitochondrial (LOC100988094), partial mRNA


The great thing about this is that you can scroll down and see the chart showing every bit of the similarity. Here's the top line of a comparison of the human COX gene and the chimp COX. That's entry #6 on my list above.


PREDICTED: Pan troglodytes mitochondrial cytochrome c oxidase subunit Va (COX5A), transcript variant X1, mRNA
Sequence ID: ref|XM_009429537.1|Length: 779 Number of Matches: 1
Related Information
Gene-associated gene details
Range 1: 133 to 776G

Alignment statistics for match #1
Score Expect Identities Gaps
1134 bits(614) 0.0 635/645(98%) 1/645(0%
)
Query 6 GCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGG

Sbct 133 GCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGG


As you can see, all the letters in the top, human line there match those in the bottom, chimp line. In fact, out of 645 letters in the whole sequence, 635 are identical between human and chimp.

Our mitochondrial COX genes are very closely related.


And the same thing can now be done for all the other genes of both species.

Don't just take people's word for who's related to whom. Have a look!


message 22: by Joshua (new)

Joshua Woodward | 556 comments Thomas Edison invented the light bulb not because it made sense. It was impossible at the time.

He believed it was possible and his passion was the drive for his reasoning and tireless efforts.

a human sacrifice to appease the genocidal Yahweh, so he won't send Jewish and non-Jewish sinners who had never heard of this pagan Jewish deity, to the eternal torture chamber

it is this evangelical view that has driven many men to hate the God of the bible. It is a view that is wrong. Jesus told a parable about a man who didn't know him, a man who suffered in this life, a miserable beggar who died alone.

Jesus taught that this man was comforted in the afterlife, the rich man who let him die alone at his from gates. He was the one who suffered. Yet we don't see a man screaming, we see a lucid figure calling out to Abraham.

These are parables of course, yet there is a sense of justice in it. I for one struggle with the gospel of the Ebionites, which presents a much different picture.

Jesus offered eternal life, a connection with God.

Peter preaching to Cornelius said "I see that in every nation whoever does what is right is acceptable to God."

The evangelical doctrine you hate Stuart is not what the apostles taught, just so you know.


message 23: by [deleted user] (new)

Oh, and the most fun of all there is, on the page with the table of BLAST comparisons on it, you can scroll up to the top and click on 'distance tree of results.'

This gives you a beautiful dendrogram (branching tree diagram) showing the human COX sequences and how closely or distantly they relate to the sequences from primates, bats (the next closest), ungulates, carnivores, lemurs, etc.

Unfortunately I may not be able to post a link because it's calculated on the spot from the BLAST results. Let's try, though. If it doesn't work, you'd need to redo the BLAST yourself to see it.

http://www.ncbi.nlm.nih.gov/blast/tre...


message 24: by Joshua (new)

Joshua Woodward | 556 comments Tell me Mark,

why are the skeletons of the kangaroo and the T-rex almost identical in structure?


message 25: by [deleted user] (new)

Joshua wrote: "Thomas Edison invented the light bulb not because it made sense. It was impossible at the time.

He believed it was possible and his passion was the drive for his reasoning and tireless efforts.

..."


Ah, so you too are distorting and rejecting century upon century of heaven and damnation-in-hell redemption theology.

It was true Christianity not so long ago.

Now it's being swept under the altar with everything else that's just not selling to an educated public anymore.

It's a view that is wrong. you declare.

You're turning into an atheist, Joshua. There is hope for you yet!


message 26: by [deleted user] (new)

Tell me Mark,

why are the skeletons of the kangaroo and the T-rex almost identical in structure?


The kangaroo and the T-rex aren't very similar. One has a massive head and walks on its toes; the other has a tiny head and rests on its forelegs, which are therefore L-shaped. As speedy bipeds, they share a big balancing tail, something us slow-moving bipeds don't require to survive. They aren't significantly more similar, though, than cow and Brontosaurus. Like crawling baby and gecko, they happen to share a stance.

The common stance arises from convergent evolution, much like the similarity between the octopus's eye and the human eye.

One good thing about sequences as indicators of relatedness is that they experience very little convergent evolution.


message 27: by [deleted user] (new)

He treats God as a causal factor 'multiplied beyond necessity.

I treat human imaginings of the possibility of "God" as superstitious make-believe.

That's what I said. I just gave the philosophical underpinnings of how you could logically justify the adult-to-child pejoration. A hypothetical causal factor 'multiplied beyond necessity' is a deemed fiction. Call it any name for a fiction that you wish.


message 28: by Joshua (new)

Joshua Woodward | 556 comments You're turning into an atheist, Joshua. There is hope for you yet!


hilarious.. I've seen too much for that to ever happen.

@Mark

the Trex is more heavy set, yes. However, have you ever seen a speedy biped in real life? There is no creature alive that can walk around like a biped on it's toes. Never mind a massive 4 tonne dinosaur. Not even a human has the capacity to run on toes for more than a few minutes. Never mind a whole life cycle.

The foot structure of a Trex is identical to a kangaroo, check it out. Think again.


message 29: by [deleted user] (new)

Mark wrote: " He treats God as a causal factor 'multiplied beyond necessity.

I treat human imaginings of the possibility of "God" as superstitious make-believe.

That's what I said. I just gave the philosop..."


Gotcha ... I think?

I do prefer the plain-talking you though :)


message 30: by [deleted user] (new)

Mark wrote: " He treats God as a causal factor 'multiplied beyond necessity.

I treat human imaginings of the possibility of "God" as superstitious make-believe.

That's what I said. I just gave the philosop..."


Does that mean you consider the Jewish Yahweh from the Bibles to be an imaginary representation of what God might be, if God were to actually exist?


message 31: by [deleted user] (new)

No, I subscribe to the Nicene creed, though not with absolute literalism over a few images like "sits on the right hand of the Father."

The logic of this deliberate unparsimony is that it's an Aristotelian Step in a proffered felicitous cycle (1,2). Somewhat like up and deciding to love someone who plausibly but unprovably claims they love you.

1. https://thismoonlesssky.wordpress.com... (basic terminology based on Aristotle's self-fulfilling prophecy logic)

2. https://thismoonlesssky.wordpress.com... (application to love and faith)


message 32: by [deleted user] (new)

The foot structure of a Trex is identical to a kangaroo, check it out. Think again.

You do realize that horses walk on the toenails of their third fingers and toes, don't you?

You also know that kangaroos rest on their legs and have quite small toes that they pull and bounce on when they're in full hop mode. T-rex walks like an ostrich. If you want me to do a more detailed comparison than that:

1) tell me why you find it important, and
2) link me to some detailed anatomical diagrams for both feet.


message 33: by [deleted user] (new)

Mark wrote: "No, I subscribe to the Nicene creed, though not with absolute literalism over a few images like "sits on the right hand of the Father."

The logic of this deliberate unparsimony is that it's an Ar..."


Hmm ... you're a part-time atheist too.

You've omitted "a few images" from what you hold to be literally true.

We've had Joshua admit that he's a part-time atheist, because he's omitted the judging the world with fire bits about Jesus he doesn't like.

And we've had a number of other part-time atheists in this forum who've deleted bits like a genocidal global flood that they recognise as being not literally true either.

And numerous issues just get ignored altogether by puffing up smokescreens of distraction and obfuscation.

And admitting a total absence of evidence for the magical, miracle stuff is never made.

Many so-called Christians today pick and choose amongst the scraps of what's left of the Christianity our great grandparents used to know, and cobble them together, and declare themselves True Followers of Christ.

Bollocks.

I hate to say it, but people like Robert and Rod are possibly the only true Christians here. They may be totally deluded and completely wrong - but they seem to be essentially honest.

For precisely the same reasons you part-time atheists omit the bits you don't like, do full-time atheists omit the bits we too recognise as imagery - we're just consistent.

And (hopefully) honest.


message 34: by [deleted user] (new)

Ah, Stuart, your wahhabism is so modern. That's the strange thing about the 20-teens - medievalism is suddenly fashionable. But in your case, it's proxy-medievalism you enjoy. No purist more pure than the proxy-purist, the fashioner of foils.

If you'd met Jesus when he was relieving the woman about to be lawfully stoned to death, you'd have told him he was well on his way to being an atheist. Maybe you think he was!

But let's suppose for a moment that he wasn't. Judaeo-Christianity has always been essentialist, you might say, or dialectical. Those reading it as ossified dogma, whether they're inside or outside the system, are plainly wrong. This trend begins in the OT with arguments with God. It's comical to see the people lobbying for a king instead of judges, and God reluctantly yielding to their undemocratic fashion-following.

Then there was Jesus, who re-interpreted, or transcended, OT laws so frequently that it's one of his main themes - though he also proclaims that not a yod of that law is to be changed. Then, just when you might think we could be left with his liberally revised version of the dogma, along comes some entity called the Holy Spirit. And look at his introduction -

"12I have many more things to say to you, but you cannot bear them now. 13“But when He, the Spirit of truth, comes, He will guide you into all the truth; for He will not speak on His own initiative, but whatever He hears, He will speak; and He will disclose to you what is to come."

"There are truths you are going to find out that are so different from anything you've encountered so far that if you heard them now, you'd think that we were all going insane. But not to worry - the spirit of God will guide you through them over time."

How can you settle into a good old dogma when its author tells you his successor will turn your world upside-down?

And yet, all scripture is good for instruction. That we're told, too.

Doesn't this situation, then, discredit Christianity as a religion where anyone who claims to hear God's voice can just make things up on the spot? Not at all. There are some proof tests of right and wrong, like 'by their fruits you shall know them.' Also, though, there is a dependence on the reality of the holy spirit, and a sense that spiritual discernment will guide those who have accepted the Messiah.

"1Therefore, having this ministry by the mercy of God, we do not lose heart. 2B ut we have renounced disgraceful, underhanded ways. We refuse to practice cunning or to tamper with God’s word, but by the open statement of the truth we would commend ourselves to everyone’s conscience in the sight of God. 3 And even if our gospel is veiled, it is veiled to those who are perishing. 4 In their case the god of this world has blinded the minds of the unbelievers, to keep them from seeing the light of the gospel of the glory of Christ, who is the image of God. 5 For what we proclaim is not ourselves, but Jesus Christ as Lord, with ourselves as your servantsc for Jesus’ sake. 6 For God, who said, “Let light shine out of darkness,” has shone in our hearts to give the light of the knowledge of the glory of God in the face of Jesus Christ.

7 But we have this treasure in jars of clay, to show that the surpassing power belongs to God and not to us. 8 We are afflicted in every way, but not crushed; perplexed, but not driven to despair; 9persecuted, but not forsaken; struck down, but not destroyed; 10 always carrying in the body the death of Jesus, so that the life of Jesus may also be manifested in our bodies. 11 For we who live are always being given over to death for Jesus’ sake, so that the life of Jesus also may be manifested in our mortal flesh. 12 So death is at work in us, but life in you.

13 Since we have the same spirit of faith according to what has been written, “I believed, and so I spoke,” we also believe, and so we also speak..."

Note that passage in boldface. There's a cautious 'traditional' interpretation on that that opines that it merely says we're mortal and vulnerable, and that was certainly a consideration in those days of martyrdom. But let's have another look there. Was there really any expectation that servanthood to Christ would give us invulnerable bodies? And anyway, we don't just have the Word in our bodies - it persists outside us and beyond us in scripture. I think the boldfaced phrase includes a reference to scripture itself. "We have this treasure in earthen vessels" means, in part, that we have the light of God's inspiration wrapped up in a cloak of human language, human linguistic concepts, and, beyond that, in the cultural contexts that gave rise to phrases like the one about the stars falling from the sky like green figs. That's what makes it easy for those who eschew or don't have spiritual discernment to scoff at the words they hear - they can easily laugh at the fragile pots of human concept that the promptings of the spirit are housed in.

Joshua and I aren't atheists. We're mainstream. Now let me make one thing clear. I've known a lot of evangelicals and other traditionalists, and for the most part, in my perception, God loves 'em to bits. They're exciting, dynamic people and when late adolescents come, after partying and whoring around too much, looking for some structure to build a life on, those folks are there for them. The occasional person gets a little judgmental and a little over worried, for my taste, about topics like evolution, but, if I'm not wrong in my viewpoint (and, of course, I may be) God can live with them taking some old testament parables as literal history. Anything practical that needs to be done can be done by someone who thinks Eve was made from a rib. How much worse to miss the light of the central truth, the extreme delight of love, the peace that surpasses understanding, the call to faithfulness.

We're not perfect, and we never were, and all the wit of all our languages isn't adequate to hold perfection except under a sediment of obscurity - a veil, as Paul says - removed only by discernment, and always holding more within it than we see at any one time.

Christianity is the non-legalistic Religion of the Book. People can read it as legalistic, but those who do otherwise may still be dedicated and orthodox Christians. That was always so, even when repressive regimes said otherwise.


message 35: by Rod (new)

Rod Horncastle Stuart says the NICEST things:
" They may be totally deluded and completely wrong - but they seem to be essentially honest."

SNIFF! Thanks Buddy.


message 36: by [deleted user] (new)

Mark wrote: "Ah, Stuart, your wahhabism is so modern. That's the strange thing about the 20-teens - medievalism is suddenly fashionable. But in your case, it's proxy-medievalism you enjoy. No purist more pur..."

As I said about great clouds of smokescreens, Mark ...


message 37: by [deleted user] (new)

Rod wrote: "Stuart says the NICEST things:
" They may be totally deluded and completely wrong - but they seem to be essentially honest."

SNIFF! Thanks Buddy."


Don't get too comfy!


message 38: by David (new)

David I don't think Stuart knows what an atheist is - there is a wide swath from fundamentalist to atheist.

You could reject the entire Bible as false and convert to Hinduism...it doesn't make you an atheist. You could reject the entire Bible but still believe in God, it doesn't make you an atheist (just ask Thomas Jefferson).


message 39: by [deleted user] (new)

David wrote: "I don't think Stuart knows what an atheist is - there is a wide swath from fundamentalist to atheist.

You could reject the entire Bible as false and convert to Hinduism...it doesn't make you an at..."


It's most unhelpful when atheists don't conform to the simplistic "atheists say there is no God" definition that Christians like to give atheists, isn't it.

But I'm not going to repeat how most of us who are atheists understand our atheism - you know it well enough. I suggest you are being disingenuous here. And I'll leave it to your god-given morality to judge how honest you are being.

As I will for Brent who took the parting shot Excellent, so Stuart is merely an agnostic, and cannot positively affirm atheism. We can now close this thread.

And as I will for Ned who confirmed that we can examine independent evidence for the biblically mention Darius and Dan and so forth, but seems to have vanished in sprinkling of angel dust when asked to do the same for Jesus plonking himself into the uterus of the Blessed Virgin Mary and all the other magical, miracle things we also find in the Bibles.

You know, all the things the part-time atheists but still true Christians sweep under the altar.

Goodbye Hell.

Goodbye transubstantiation.

Goodbye mud and rib Homo sapiens.

Goodbye genocidal global flood.

Goodbye virgin birth.

Goodbye Solvet saeculum in favilla

And all the other things my new Best Buddy Rod still takes literally.

There are grades of atheism, just as there are grades of Christianity. Those of you who are still climbing upwards out of the dark pit of belief and sloughing off the scales of literalism as you go, are part-time atheists.

How honest you are with yourself and others, I will leave up to Rod to judge.

Go Buddy ...!


message 40: by Joshua (new)

Joshua Woodward | 556 comments I'm not sure being unorthodox makes one an atheist. Jesus was highly unorthodox, and still is I would say.


message 41: by Joshua (new)

Joshua Woodward | 556 comments The power of Christ is not in the institution. The "pit" as you call it. It is in the way He keeps appearing to people and changing lives. The early church was incredibly diverse.


message 42: by [deleted user] (new)

We shall leave Stuart here, perhaps, as the last true Christian, while we go on with Christianity.

Le roi est mort, vive le roi!


message 43: by Joshua (new)

Joshua Woodward | 556 comments @ Mark,

it just intrigues me

http://hopereformation.com/2014/11/05...

As you correctly point out the foot structure is like a horses which stands on it's "toes" however there aren't any living examples of a mammal footed biped, except of course the kangaroo.

Why is it important? children all across the world are taught that birds evolved from mammal footed bipeds.


message 44: by [deleted user] (new)

I used to see these little guys http://en.wikipedia.org/wiki/Western_... , the jumping mouse, from the baler as we went through the hayfield - that was when I was 15. I guess they settle on all fours but definitely run sproinging on two legs, like a kangaroo.

Anyway, back to the original matter. There seems to be a lot to this kangaroo vs. therapod question, but just as a sketchy google mission:

http://finstofeet.com/tag/birds/

The author of that post seems to know what he's talking about in comparative anatomy. It seems that when proto-reptiles evolved out the eventual bird lineage(s) and the eventual mammal lineage(s), the bird line at a certain point developed an apomorphy (brand new character) wherein the tibia and fibula were reduced into a single bone called the tibiotarsus. Later on, the three metatarsals of the ancestral pattern, which were already modified by one becoming a tucked-in artctotarsus, fused or were reduced into, again, a single bone, the tarsometatarsus.

The kangaroo, being off on quite another lineage of creatures, retained the original pattern of three metatarsals and, above them, a tibia and fibula. http://marshaluhls.deviantart.com/art...

Hence the similarity with T-rex: it's a so-called symplesiomorphy, a shared ancestral-type character.

The character ("-morphy") terminology is from the book Phylogenetic Systematics by Willi Hennig - one of the most influential scientific books of all time.

Phylogenetic Systematics


message 45: by Joshua (new)

Joshua Woodward | 556 comments fascinating little creature that mouse.

your logic looks backwards to me.

The kangaroo, being off on quite another lineage of creatures

does not the remarkable similarities raise the question? by comparison a bird has no semblance at all.

By evolutionary thinking similarity in design is the sole basis of determining a creatures place in the evolutionary tree. Is that not why they think we came from apes?

How can our descent from apes be a reasonable proposition if the kangaroo (having the same type of feet, forelimbs, large tail, etc etc) can be considered to have no relationship at all to the t-rex?

Perhaps the tail is wagging the dog.


message 46: by Rod (new)

Rod Horncastle THanks Stewie:
"How honest you are with yourself and others, I will leave up to Rod to judge."

Not interested - I just assume everyone lies. :C(


message 47: by Steve (new)

Steve Goble Joshua wrote: "fascinating little creature that mouse.

your logic looks backwards to me.

The kangaroo, being off on quite another lineage of creatures

does not the remarkable similarities raise the question? b..."


Hi. I'm new here. I'd like to make a couple of points regarding evolution in response to your comments, if I may.

1) Similarity of design is not the sole basis of determining a creature's place in the evolutionary tree. Genetics, geography, placement in the fossil record, etc., all play roles in that.

2) Kangaroos DO have a relationship to T. rex, as do we. So do foxes, gerbils, squid, etc. We're all on the same evolutionary tree, even if we're not all on the same branches. But when you work your way back in time to the "trunk," all animal life is related.

3) The human relationship to other apes is established through more than just similarity in design. There is genetics, there is the fossil record as traced through geography, etc.


message 48: by Joshua (new)

Joshua Woodward | 556 comments of course you may. your thoughts are just as valid as mine.

it's a pet topic for me. I find the similarities quite affronting.


message 49: by Steve (new)

Steve Goble Affronting, how?


message 50: by Joshua (new)

Joshua Woodward | 556 comments Well the skeletal structure is almost identical. Like a terrier skeleton would be similar to a Labrador. Primary school teaching of evolution is usually based on the development of birds from therapods.

However if therapods were mammals that a big oops. But you may say they laid eggs. Perhaps, but here in Australia we have the platypus, an egg laying mammal.

I don't think anyone thinks birds could have evolved from mammals.

So you see this little question begs much larger questions. In the pressure of accepted thought I could perhaps make room for conventional evolution to be a thing, but then the kangaroo says conventional thought is possibly entirely wrong and I imagine a world with giant bouncing therapods.

makes me laugh everytime.


« previous 1
back to top