As you swim through the protoplasm, you are certain to encounter one particular molecule of critical importance: a long, strand-like molecule called ribonucleic acid or RNA. RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.VI You might imagine it as a set of instructions; a Morse code stretched along a tape. One particular RNA, freshly made in the cell’s nucleus, may arrive carrying the instructions to build,
...more

