The Song of the Cell: An Exploration of Medicine and the New Human

by Siddhartha Mukherjee

As you swim through the protoplasm, you are certain to encounter one particular molecule of critical importance: a long, strand-like molecule called ribonucleic acid or RNA. RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.VI You might imagine it as a set of instructions; a Morse code stretched along a tape. One particular RNA, freshly made in the cell’s nucleus, may arrive carrying the instructions to build, say, insulin. Other strands, encoding different proteins, might be floating by. How are these instructions decoded? Look left or right, and you’ll spot a massive macromolecular structure called a ribosome, a multipart assemblage first described by the Romanian American cell biologist George Palade in the 1940s. You can’t miss it: a liver cell, for instance, contains several million of them. The ribosome captures RNAs and decodes their instructions to synthesize proteins. This cellular protein factory is itself made of proteins and RNA. It is yet another of life’s fascinating recursions, in which proteins make it possible to make other proteins.