The Song of the Cell: An Exploration of Medicine and the New Human

by Siddhartha Mukherjee

RNA strands are made of four subunits: adenine (A), cytosine (C), uracil (U), and guanine (G). One strand might consist of ACUGGGUUUCCGUCGGGGCCC for thousands of such subunits. The strand carries the message, or code, to build a protein.