The Body: A Guide for Occupants

by Bill Bryson

sixty random Americans had their belly buttons swabbed to see what was lurking there microbially. The study found 2,368 species of bacteria, 1,458 of which were unknown to science. (That is an average of 24.3 new-to-science microbes in every navel.)

The one known cure for baldness is castration.

The DNA of bacteria is less scrupulous in its proofreading, too, so they mutate more often, giving them even greater genetic nimbleness.

Altogether your private load of microbes weighs roughly three pounds, about the same as your brain.

A VIRUS, IN the immortal words of the British Nobel laureate Peter Medawar, is “a piece of bad news wrapped up in a protein.”

In a similar study at the University of Arizona, researchers infected the metal door handle to an office building and found it took only about four hours for the “virus” to spread through the entire building, infecting over half of employees and turning up on virtually every shared device like photocopiers and coffee machines.

From a human health perspective, the most notable protists are those from the genus Plasmodium. They are the evil little creatures that transfer from mosquitoes into us and give us malaria.

a lab assistant in Peoria named Mary Hunt brought in a cantaloupe from a local grocery store. It had a “pretty golden mold” growing on it, she recalled later. That mold proved to be two hundred times more potent than anything previously tested. The name and location of the store where Mary Hunt shopped are now forgotten, and the historic cantaloupe itself was not preserved: after the mold was scraped off, it was cut into pieces and eaten by the staff. But the mold lived on. Every bit of penicillin made since that day is descended from that single random cantaloupe.

Antibiotics are about as nuanced as a hand grenade.

“From the 1950s through the 1990s,” he says, “roughly three antibiotics were introduced into the U.S. every year. Today it’s roughly one new antibiotic every other year. The rate of antibiotic withdrawals—because they don’t work anymore or have become obsolete—is twice the rate of new introductions. The obvious consequence of this is that the arsenal of drugs we have to treat bacterial infections has been going down. There is no sign of it stopping.”

At the current rate of spread, antimicrobial resistance is forecast to lead to ten million preventable deaths a year—that’s more people than die of cancer now—within thirty years, at a cost of perhaps $100 trillion in today’s money.

GTGCCAGCAGCCGCGGTAATTCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG.

Every living being on Earth has these.

The brain is wider than the sky, For, put them side by side, The one the other will include With ease, and you beside. —EMILY DICKINSON

A morsel of cortex one cubic millimeter in size—about the size of a grain of sand—could hold two thousand terabytes of information,

Your brain requires only about four hundred calories of energy a day—about the same as you get in a blueberry muffin. Try running your laptop for twenty-four hours on a muffin and see how far you get.

The basal ganglia, for instance, play an important part in movement, language, and thought, but it is only when they degenerate and lead to Parkinson’s disease that they normally attract attention to themselves.

To help us deal better with this fractional lag, the brain does a truly extraordinary thing: it continuously forecasts what the world will be like a fifth of a second from now, and that is what it gives us as the present. That means that we never see the world as it is at this very instant, but rather as it will be a fraction of a moment in the future. We spend our whole lives, in other words, living in a world that doesn’t quite exist yet.

It is a strange, nonintuitive fact of existence that photons of light have no color, sound waves no sound, olfactory molecules no odors.

Most other mammals never suffer strokes, and for those that do, it is a rare event. But for humans, it is the second most common cause of death globally, according to the World Health Organization.

One of the early symptoms of Alzheimer’s is smell loss.

It is your brain that reads these scentless, flavorless molecules and vivifies them for your pleasure. Your brownie is sheet music. It is your brain that makes it a symphony.

“Blood is a living tissue,” says Dr. Allan Doctor of Washington University in St. Louis. “It’s as alive as your heart or lungs or any other organ. The moment you take it out of the body, it begins to degrade, and that is where problems begin.”

It turned out that in some cases it can be better to let patients be anemic than to give them someone else’s blood, especially if that blood had been in storage for a while—and that is nearly always the case.

We get through a lot of insulin. Each molecule only lasts from five to fifteen minutes, so the demand for replenishment is relentless.

In type 1 diabetes, the body stops producing insulin altogether. In type 2 diabetes, insulin is less effective, usually because of a combination of decreased production and because the cells on which it acts don’t respond as they normally would.

Medical students learn to remember the principal attributes of the spleen by counting upward in odd numbers; 1, 3, 5, 7, 9, 11. That is because the spleen is 1 x 3 x 5 inches in size, weighs 7 ounces, and lies between the 9th and the 11th ribs—though in fact all those numbers but the last two are merely averages.

“Cartilage is remarkable, too. It is many times smoother than glass: it has a friction coefficient five times less than ice.

THE SURFACE LAW is not something most of us ever have to think about, but it explains a lot about you. The law states simply that as the volume of an object grows, its relative surface area decreases.

Allergy rates vary across the world from about 10 to 40 percent, with the rates closely following economic performance. The richer the country, the more allergies its citizens get.

About seven hundred people a year die in America from anaphylaxis, the formal name for an extreme allergic reaction causing restriction of airways. These reactions are brought on most often by penicillin, foods, insect stings, and latex, in that order.

Thirty-five million Americans suffer sinusitis every year, and about 20 percent of all antibiotic prescriptions are for people with sinus conditions (even though sinus conditions are overwhelmingly viral and thus immune to antibiotics).

Air pressure in the chest is less than atmospheric pressure, which helps to keep the lungs inflated.

Even now textbooks say that the way people get asthma is by being exposed to allergens early in life. Basically everything in that theory is wrong. It’s clear now that it is considerably more complicated than that. We now know that half the cases in the world involve allergies, but half are due to something else altogether—to nonallergic mechanisms. We don’t know what those are.”

hygiene hypothesis—the idea that early exposures to infectious agents strengthen our resistance to asthma and allergies later in life.

Pearce made a curious discovery—that people who had had a cat early in life seemed to derive lifelong protection from getting asthma.

A hiccup is a sudden spasmodic contraction of the diaphragm, which essentially startles the larynx into closing abruptly, making the famous hic sound.

The calorie is a strange and complicated measure of food energy. Formally, it’s a kilocalorie, and it is defined as the amount of energy required to heat one kilogram of water by one degree centigrade,

a 150-gram serving of white rice or a small bowl of cornflakes will have the same effect on your blood glucose levels as nine teaspoons of sugar.

A single standard-sized can of soda pop contains about 50 percent more sugar than the daily recommended maximum for an adult.

It is important to distinguish between probability and destiny.

An investigation by the Food and Drug Administration in 2016 found that 84 percent of chicken breasts, nearly 70 percent of ground beef, and getting on for half of pork chops contained intestinal E. coli, which is not good news for anything but the coli.*1

As an experiment, we asked a lady who was completely blind—she had lost her rods and cones as a result of a genetic disease—to tell us when she thought the lights in the room were switched on or off. She told us not to be ridiculous because she couldn’t see anything, but we asked her to try anyway. It turned out she was right every time. Even though she had no vision—no way of ‘seeing’ the light—her brain detected it with perfect fidelity at a subliminal level. She was astonished. We all were.”

We know it is not just coincidental that these things have seasonal peaks and troughs because the patterns are six-month-shifted from the Northern Hemisphere to the Southern.” Whatever people do in a northern spring—like commit suicide in greater numbers—they do six months later in the southern spring.

The pressure to sleep grows more intense the longer we stay awake. This is in large part a consequence of an accumulation of chemicals in the brain as the day goes by, in particular one called adenosine, which is a by-product of the output of ATP (or adenosine triphosphate), the little molecule of intense energy that powers our cells.

It wasn’t until 1990 that two teams in London, at the National Institute for Medical Research and at the Imperial Cancer Research Fund, identified a sex-determining region on the Y chromosome that they dubbed the SRY gene, for “sex-determining region Y.”

But if all goes well, within a week the zygote has produced ten or so cells known as pluripotent stem cells. These are the master cells of the body and one of the great miracles of biology. They determine the nature and organization of all the billions of cells that transform a little ball of possibility (known formally as a blastocyst) into a functioning and adorable little human (known as a baby).

Formerly known as toxemia, preeclampsia is a condition in pregnancy that leads to high blood pressure in the mother, which can be a danger to both her and her baby. About 3.4 percent of pregnant women get it, so it is not uncommon.

The placenta acts as a barrier to pathogens, but only to some. The notorious Zika virus, for instance, can cross the placental barrier and cause terrible birth defects, but the very similar dengue virus cannot cross the barrier. No one knows why the placenta stops one but not the other.

You leave the womb sterile, or so it is generally thought, but are liberally swabbed with your mother’s personal complement of microbes as you move through the birth canal. We are only beginning to understand the importance and nature of a woman’s vaginal microbiome. Babies born by Cesarean section are robbed of this initial wash. The consequences for the baby can be profound. Various studies have found that people born by C-section have substantially increased risks for type 1 diabetes, asthma, celiac disease, and even obesity and an eightfold greater risk of developing allergies. Cesarean babies eventually acquire the same mix of microbes as those born vaginally—by a year their microbiota are usually indistinguishable—but there is something about those initial exposures that makes a long-term difference.

about four women in every ten are given antibiotics during delivery, which means that doctors are declaring war on babies’ microbes just as they are acquiring them. We’ve no idea what consequences this has for their long-term health, but it’s unlikely to be good.