Emily Suvada

Dayspring
590 books | 72 friends

Joanna ...
1,606 books | 116 friends

Adri
1,434 books | 537 friends

Jeann (...
1,626 books | 2,918 friends

Luke El...
512 books | 386 friends

Elbie
704 books | 12 friends

Lia
Lia
611 books | 1,316 friends

K.E. La...
87 books | 837 friends

More friends…

Emily Suvada

Goodreads Author


Born
Sydney, Australia
Website

Twitter

Member Since
March 2014

URL


Emily Suvada was born and raised in Australia, where she went on to study mathematics and astrophysics. She previously worked as a data scientist, and still spends hours writing algorithms to perform tasks which would only take minutes to complete on her own. When not writing, she can be found hiking, cycling, and conducting chemistry experiments in her kitchen. She currently lives in Portland, OR, with her husband.

Average rating: 4.14 · 10,869 ratings · 2,351 reviews · 6 distinct worksSimilar authors
This Mortal Coil (This Mort...

4.15 avg rating — 7,149 ratings — published 2017 — 13 editions
Rate this book
Clear rating
This Cruel Design (This Mor...

4.15 avg rating — 2,454 ratings — published 2018 — 14 editions
Rate this book
Clear rating
This Vicious Cure (This Mor...

4.17 avg rating — 858 ratings — published 2020 — 10 editions
Rate this book
Clear rating
These Precious Scars (This ...

3.83 avg rating — 397 ratings — published 2018 — 5 editions
Rate this book
Clear rating
Mortal Coil Trilogy: This M...

really liked it 4.00 avg rating — 1 rating
Rate this book
Clear rating
Nightmare Magazine 62: Nove...

by
4.10 avg rating — 10 ratings — published 2017
Rate this book
Clear rating
More books by Emily Suvada…
This Mortal Coil This Cruel Design This Vicious Cure
(3 books)
by
4.14 avg rating — 10,857 ratings

Upcoming Events

No scheduled events. Add an event.

Emily’s Recent Updates

Emily Suvada is now following
14593331
Emily Suvada rated a book it was amazing
This Vicious Cure by Emily Suvada
Rate this book
Clear rating
ACTGAGCTTGCTCATGAGCGATGGTCGTCATGTCCGTGTAAAGATTTTACCCTCCGACCCTCCCTGCGAGCCATCAGGCTTCGTAGACTCCTCGTGTCGACATGAGCTGGTTTCGCCAACAGGCTACCTCGCTCACTCCGACCAACGATTAGACCATGTTTCCTAATGAAGTCGCTTGGATAGGTCGAGGCGAGCTCGTCAACTCGGGTGGCACCTACCAGATGTGGAAACCACCTCAAGACCACCGGTC ...more
Emily Suvada rated a book it was amazing
Goddess in the Machine by Lora Beth Johnson
Rate this book
Clear rating
This book is glorious. And Lora Beth is a genius. I don't say that lightly - the language of this future world has been stunningly, carefully, painstakingly crafted and is a feast for pretty much anyone who's into words. Which I'm guessing is you, si ...more
Emily Suvada has read
This Cruel Design by Emily Suvada
Rate this book
Clear rating
AGACAGCTTGGTCATCTCCGTACCACCTCATGACCCACATATGTATATAGGTACAGAGCACGAGTGCACTTCTCGTCGTAACCGCAAGACGGAAGGAGCCACTGTCCCTCCAAGGAAATGAGGATGTTTCCATAACTTCAGGCAACGATAGGACCTGGCCACGACGAGATCAGCGGACGCTACGTGCCTATTACGTAGTGAGGTTACGACCTGTTGTGCTAAACACGAGGATTTCATATTAGGTTGCTAG ...more
Emily Suvada rated a book it was amazing
Wilder Girls by Rory Power
Wilder Girls
by Rory Power (Goodreads Author)
Rate this book
Clear rating
Emily Suvada answered a question about This Cruel Design:
This Cruel Design by Emily Suvada
Hi! Congrats on winning This Cruel Design! Unfortunately this book is a sequel in the truest sense of the word and it won't make much sense without having read This Mortal Coil.
This Mortal Coil by Emily Suvada
" It's a coded message like the pigeon poem in the book! Check out http://emilysuvada.com/extras/the-pig... for details on how to decode it :D ...more "
Emily Suvada has read
This Mortal Coil by Emily Suvada
Rate this book
Clear rating
TCAGACATACGAGTAATGGATTACAGGTGCGAAGCTGTGGATGTAATAAGGCCATCACGACCGCTGGGACTCATCTATATAGCCATGCACGAGGCCAAGTATAATCCACCAGTCCCACAGACCTTAGCACCAGTTAAAGATAATTGGTACCAACCACCGGTGGCAAGATAGATTATTGCCTTCAAGCAACTCTCCATTAGTGCTACTTACGTCATCACGTGGGATCGTACGCTAGTTTACTAGTTTAATG ...more
Emily Suvada wants to read
Untitled by Lora Beth Johnson
Rate this book
Clear rating
Emily Suvada rated a book it was amazing
Goddess in the Machine by Lora Beth Johnson
Rate this book
Clear rating
This book is glorious. And Lora Beth is a genius. I don't say that lightly - the language of this future world has been stunningly, carefully, painstakingly crafted and is a feast for pretty much anyone who's into words. Which I'm guessing is you, si ...more
More of Emily's books…
“When you love someone for their mind, you can't expect that their heart will belong to you too.”
Emily Suvada, This Mortal Coil

“It’s funny, that saying—I’d rather die. It’s funny because nobody means it. The truth is that when you’re facing death, there’s no telling what you’ll do.”
Emily Suvada, This Mortal Coil

“Most of human behavior and its relationship to DNA is still undiscovered territory. We know what genes make rats afraid of eagles, and we know why birds fly south in the winter, but the complexities of human nature are still a mystery to science.”
Emily Suvada, This Mortal Coil

Polls

Which YA Sci-fi series is the best? If you haven't heard of these, you really should go read them.

 
  5 votes, 55.6%

Arc of the Scythe by Neal Shusterman
 
  4 votes, 44.4%

 
  0 votes, 0.0%

 
  0 votes, 0.0%

 
  0 votes, 0.0%

More...

Topics Mentioning This Author

topics posts views last activity  
A Million More Pages: Feb Audio Book Challenge 76 112 Mar 03, 2018 08:01PM  
This Book is amazing!!! 1 15 Apr 04, 2018 06:10AM  
A Million More Pages: Cinderella's Team 2842 146 Jun 30, 2018 08:48PM  
A Million More Pages: * Once Upon a Book - Cinderella 837 132 Jul 01, 2018 01:24PM  
Aussie Readers: July Challenge - Cover Hunt 269 233 Aug 05, 2018 03:47AM  
2020 Reading Chal...: >> l a i n e y’s challenges corner << 24 213 Aug 05, 2018 09:59PM  
220 Goodreads Librarians Group — 111526 members — last activity 0 minutes ago
A place where all Goodreads members can work together to improve the Goodreads book catalog. Non-librarians are welcome to join the group as well, to ...more
126236 SFWA Pacific Northwest Reading Series — 48 members — last activity Jan 29, 2020 10:38PM
The greater Pacific Northwest is home to Ursula K. Le Guin, Kay Kenyon, Jay Lake, Nancy Kress, Brent Weeks, Ted Chiang and Ramona Quimby. Although Ram ...more



No comments have been added yet.